Homo_sapiens Locus Mono:205:AL109931.18
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:205:AL109931.18
Homo_sapiens
Mono:205:AL109931.18
X
SNORA4L1
1001..1147
2147
TGGTTTGACTCTGAAACGAAATTGATAATAGCTCTTTCCTGAAAAGACCCCTTTCTTGC
CTAGGGACCAATCTGCCTTTGCAGGACTAACAAATTAGCTACAAGATTAGAAATTATGCT
TCAGGGGTTATGCAGCTTCTGGCTGCAAGAGTCTGAACCTTCCCAAATTGCTCCTGGGGG
TAACATTACTACTGTAGAACCTAAGGTCAGTGCTTGAGATATTTTGCAGACCCTGCACTA
GATGGATTAGCTGACACCACCCAGAGTGGTAATCTGACTCAACCAGTTCTGCAATCCCAA
CCAGAAACAGAATACAGTGAGGAAACGTCACTTCAGCCCCCTATGATTCCATCTCCAACC
TGACCAATCAGCACTCCCCACTTCCTGAGCCCCTACCCACCAAATTATCTTTAAAACCTT
GATCTCTGAGTGTTCAGGGAGACTGATTTGAGTAATAATAAAACTCCACTTTCCTACACA
GCTGGCTCGGTGTGAATTATACATTCTTCATAGCAATTCCCCTGCCTTGATAAATAAGCT
CTGTCTAGGCAGCCAGCAAGGTGAACTTCTTGGGTGGTTACAATTCCAGTTACTTGGGGG
GCAAAGGTGAAGGATCACTTTAGCCTACGAGGTCAAGGCTGCAGTGAGCCATGTTTGCAT
GACTGCACTCCAGCCTGGGTGACAAAGACATACCCTGTCTCAAAAAAAAAGAGGAAGAAA
AAAAGAAACAAAGAACAAATGAAATGAATAGAAAATATTTATAAGGGTGAAATATATCAA
TCATGTATATTAATATAAATAGAATATTAGTATAAATAATTACTTTAAATATGATGGTCC
AAACATACTAACTAAAGATAGAAATTGTCAGAGTGGGGAAAGAACAAAATCAACTGTATA
TGTCTAAAAGAAAGACACTTTCAATGTAAAGACACAGATAATTTAAAAATAAAGAGGTAA
AGAAAGGTATACAGTGTTAACATTTATCAAAACAAAGCGTGTTACCAAAAGTTAATGTTT
TCAGAGAATGCTTTGGTTAAAAAGCCTTTACCAACTTGGGCTGTTTGGGATAATAATGTT
GGCCACTTTCCACAGTGGGTTATAACATTAATATATATATAAGTCACTATTAGTTTGTAA
TCTACATTACATAAGTGTAAAAAAAGTGTGAGTAGCTATATTATTTTTTGAAAAGGCAGA
TTTCAGAGAAAGTGAAATGATCAGAAATGAAGAGCCATTTTTAAATGATAAAGGGTCAAT
TCTTTAAGAGAATATAACAATCCAAAACATGTACACACCTAAAAAGTAGAGTATGTGAGG
CAAGAACTGACGGCACTGCAAAGATAAACAGACAAATCTACTTTTATAGTTGGAGACATC
AACAACTCAATGTAAGTAACTGACAGATTAAGCAGGCAAAATATCAGTAAGAATAAAGAT
GGCCTAAGCATCACTTCAATCAATTTGATCACTTAGCAGTTATAGAATTATCCATATGAA
AAGAGCATAATACACATTCTTCAAAAACACACATGAAATATTAAAAAGAACACATTTTGT
GCTATAAAACACATCTTAACACATTTGAAAGACTGTATCAAATAAAAAATAAAGTATGTT
CTAGACCACAATAAATATGAATCAATTTTGTAAAAATTTACTTCAAATATTAACATGTTT
TTAAATAACCCGTGGTTCAAAAAAATTAAATGTAAAAATCATTTTAGCTACATGAAAACA
AAAATATAATCAGAATTTGTGGGATGCAAAGTTAGCCATTCTTAAAGGAAAATGTGTAGC
ATTAAATTATATATTTGCCAGAGCAATCAGGCAAGAGAAAGTAAAAATGGCATTCAAGTA
GGAAGAGAGGAAGTCAAATTATTCCTGTTTGCAGACAACATGATCCCATATCTAGAAAAC
CCCATAGTCTAAGCACAAAAGCTCCTTCAGCTGATAAAATACTTCAGCAAAGTTTCAGGA
TACAAAATCAACGTACAAAAAAATCACTAGCATTTCTACACACAAACAACAGCCAAACAG
AGAGCCAAACCAGGAAGGTAGTCTCATTTACAATTGCCACAAAAAGAATAAAACACCTAG
GAATTGCAGCTAACCAGGAAGGTGAAAAATCTCTACAATGAGAATAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved