Homo_sapiens Locus Mono:177:AC108667.9
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:177:AC108667.9
Homo_sapiens
Mono:177:AC108667.9
3
SNORA72L3
1001..1129
2129
CCTAAGATGGTGAAACCCCATCTCTACTAAAATTACAAAAACAAAATTAGCCAGGCGTG
GTGGCGGGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGAATGGGGTGAACT
TGGGAGGCGCTCTGCACTCCAGCCTGGGCGACAGAGCAAGACTCAGTCTCAAAAAAAATA
ATAATTCTCCCAGCCTGGCCAACATGGTGAAACCCCATCTCTACCAAAAGATACAAAAAT
GAGCTGGGTGTGGTGGCACATGCCTGTAGTCCCAAGTGCTCGGGAGGCTGAGGTGGGAGA
ATCACTTGAACCCAGAAGGCAGAGGCTGCAGTGAGCCAAATCAAGATTGCACCACTGCAC
TCCAGCCTGGGCAACAGAGTGAGACCCTATCTCAAAAATTTTAAAGAAAGAATTCTCAAA
ACTCAGAAGGAAACAACCCAATTTAAAAGTGGGCAAAAAACACGAACAGTTATTTCAACA
AAAAAGATATACAGATGTCAAATGAAGACAATATGTTCAACATCATTAGTCATTACGAAA
ATGAAAACTGAAACCACAATGAAAGATTCTATTTTTCCAATATTTCTCAAATCTATCCTC
TTATCAACACTGATACTATCCTAAAAAGTTCAGATCTTCAAAATCTCTCCCAACTGCTGA
AATAGCCTCTAAATTATCATTGATTCCCCAATTTCCCCTCTTGAATTCCTCCTTCAAAGT
GAACCAAGTTATCTTTCTGAAATGCAAGTCAGATATTATTGATCTCTCGTCTCATAAAAA
AATTATTCTATAGCTTAGATAATATAGCACACCACTCAAAGGCCTTCTCTAGATTGGTAT
AGGCCATCTCATCTCAACTGTCACTGTATCCATATGCCTACTACACCCTTGCTATTGATA
ATACAGAATGATCACTTGTATTGTTTACTCGGTCTCAAAGACACTTCTCATCTATATCCT
CTACTTGTACCAATCATATTCATACTTTAAAATTCACTTCATTATGAATATACTCACCGT
TTTGATTTTATAATAGTAACGACAAGCTAAACATTCACTATATTAAGACCACGCGTGTGT
CTCAGACTTACCTTTCCCTAGGTCTGTTTTTATAAATGCTGGTGATAAACCAGCTCTGAC
TTATATGATCATTTTGTATGACCATCTAAGGGCTGTGATTCTATGTTACCTTTAGTCATC
TTTAAGGAAAATGATAGTACAGCTAATCTAATAACTTTTGCAAATAATCAGTGCTAATTT
GGAAACTTCTGTCAAAAAAAGGCATTACCAAAGGAAGGAAATTTCATGTGTACCAGCTGC
TATTAAATAAACTGTGAAATTACTGTATTTTTCTAGAAAAAAAAGTTCACTTCGATCATT
ACCTTCTGTATGAAGCTTTTTCTGATGCACAACACACAGAAAATTCCAGGCCAATACCTT
CCCTAAACTAAACGAGTAGTAAAACTCTCACTTTACAAATCTAATACCTTAACTCCTTTA
TTATGCTGATACCTTCCATTTGGTAATTATAATTGTGTATGTTTTATCTCCTCTTCTAGT
ATAAAGTTCTTTAAAAAAAAAAATCTTTAACACTTAGCACAGTACTTTATATTAATTAGG
CATCCAAGTAGTATGTGGAATAAAGAAGCCTCTGGATATTCATTTAATTTTGAGGATAAG
CTATAATTAAGTTATTCCAAATCCTATCCCCCCAAAAAGGAAAATATCAGTCCTAAAACA
AAGCTCTTTAATGAGAATATTATCATGGGCTGGGTGCAGTGGCTCAGGCCTGTAATTACA
ACACTTTGGGAGGCTGAGGCAGGAGAATCACTTGAGCACAGAAGTTTGAGACCAGCCTGG
GCAACATAGCAAGACCCCATCTGTATAAAAAAAAATTTTTTTAAGGAGAGAATACTATCA
TGAATTTAGGCCACAATCTTTTAAACAAACCTTTGATGAGTTTATACTAAGCAAAGTGGT
ATGAAACTTTCTCCAGTCTAATAATTTCGTGAGATTTTTTAAAAGGAGTTTTAGTGAATT
TAATTGATATGCAAATTAGAATTCTGAAACTTCAATGCATTTTACCATGGCTTGAAAGAA
TTTACATTTCTAAGCAATAAATGCTACTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved