Homo_sapiens Locus C5orf26
snOPY snoRNA Orthological Gene Database
Homo_sapiens C5orf26
Homo_sapiens
C5orf26
5
SNORA13
1635..1767
3457
TTAAAATATGTTGGGTTATTATTAAAATTAATTTGATCTGTTTCTTTTTACTTTTTTTT
TTTTTTTTTTGAGACGGAGTTTCGCCCTTTTGTCCAGGCTGGAGTCAAGTGGCATGATCT
CGGCTCACCGCAACCTCCACCCCCACCCCGCCCGGGTTCAAGCCATTTCTCCTGCCTCAG
CCTCCCAAGTAGCTGGGATTATAGACGCCCGCCACCAAGCCCAAGTAATTTTTGTATTTT
TAGTAGAGACGGGGTTTTGCCATGTTGGCCAGGCTGGTCTTGAACTCCTGACTTCAGGTG
ATCACCTGCCTCAGCCTGCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCGCCCGGCG
TTCTTTTCACATTTTATGTGGCAATTGGAAAATTTAAAATTACACTCATGGCTCACACTG
TTTCCATCGGACAGCGCTACCCTATGGCATGACCCTCTTTTGCTGCCCTCCTGGCACTTA
CATTGTAGAATTTCAGCATCCGGGCTCACTTGGTCAGTGGCCTACTCACCCAAGCAGAAT
GTACCACAGAAACCTTGCCTGGCTCACCCACACCTGATTCCCAGGCACTCAGGCCAGGGC
CTGGAGCATAGTAAGTGCTGACTAAATATCTTTCGAATGAATGACTCTACTCTTCCTCAG
CTGGACTCATGAATTCTGTCGGGTCCCAAAATACGTGGTCTAAAGTCCTTTGGGCTCCTG
CCGCTGCCAGCACTGATCATATGCTCTTGACCCTGGTCGGGTGGGGGGATGTCTGGATAC
CTCCTCTGTGGAAAGAACTGGCCACACATCCGCAGAGGTGACTCGGGCTGAGAACCCAGG
CTCCTCCTCCCTTTGGTGACACGCCCCTCGGTCCCTCACTGGCACTTCTCCCTCCGGCCA
CACGGCGGCGTCTCGCCATAGCGCAGCGGCCGATGGTACAGCCCGCTCCCCCCTCGCGCT
CTCGGACAGTGGGTCCTTCCACTTGTAGAAAAGCATTGTGGGACGGAAGCCTGTCCTTTC
TTCCTTTTGGTGCGAGCTTGCTGTGGTTTTTGCTCTGGGTCCTCTGGGATGGCGCCTGGC
TGTGGCCGCGTGGTCTCTCACGCAGGGGCGCCGGGCGGGGGAACGCGGCCACCCTGAGTC
TGGTGAGTCGACTGCGGCGGCCTGTGTCCGAAGTGTCCGGGGCCGTGAACAAGGGCAGCG
GCCTGGCCTCAGGCCTGCGTTCCCACGTTTGGAAACGGGGAGCTTCGTCGATTTGTGTTT
ACATCATCGACTATGCCAGGGAGTTCTCCAGATAAGCCTGGTTTTATTTTCGTCAGTGAA
AAGGCCTTACCGTATAACTGACTTTATGCTTGCCCTGCCCCCGTATAAAATAACTTAAAA
GCAGCGTGCCTGGTTACAGCTGTTTCCACGTGCGGTGCTCGTCGGGAGTGATCACCTACC
CTACAGGTGAGTTTTCACGTTCGTGCAAGACCAGTCGCCATTTAAAACGCATCGCATTTC
ACTTTTCATTATTAAGTCGGATTTTAAATCGTGAGAAAATTTCTCTGAAATGTATTGTCC
GTTTTTAGGCTGTAATCGGCATTACTGTCAGCCAGTCAGCAACCTTATGCCATAAAGCCT
ACCTCACGCAGTGTCAGCCTTTGTGTTGCCCATTCACTTTGGAAACTAGTGAATGTGGTG
TCAAAAAAGGCGTAAATTAAACGCTTTGCAGCCTTTTCCTGCCCTTAAATTTGATACCTT
TGGTGTAGGAGCTGCATAAGTAACAGTTGCTGCTTTTACGTTTCCACGCGTGATCTTGAC
CCTGCTAGCCTTAAGTGTATGGTTTCTCTTAGCCAGTTCTAATTTTTGTTCAGGTGGAAG
ATGGATGCCTGAAGTGTAGACTGCTGCTAGCTGAATACCATCTGGGAGCATAAAGGTGAC
CTGAAGGTAGGGTGATATGTCTTAAAGCACTTTGTAATGGGAATTTTTATCACCTTTTAA
ATTGGGGTTCCTTCTCTAGTGAGTTTTAATGTCAGTGGTACATTCGTAGTGTTGCTCTGT
CTGTAGCTATTAAGGTGAGTTAATAAATGGGATAGCCTCCACAGCTTATTTTTGGGAAGG
TTTTGCTGATACTTCCTGAGAAGCCCAGGGAAATAAATACGCATAGTACTGGCATTCTGC
ATCTCTTTAAGATTTGTTTTTATGTGTAGTAATTGAGTTTTTTAAAAGCTTGTGAAATCG
CAGGCATATTACCAAGTTCTTGATTAAAATGTAATACAAAAATATTTGCTGTCGAATTGA
GTACTTTATTTTTTCTCTTAGGATGTCCTTGGTGAGGATTTTGAAAATTTGATCTTCACA
AGAGTTGCCTGGATCATTTGAAATTTCTGGGAGTCTGAGGAGTACTGACATAATTACCTG
CTGGAGTCTGTAAATACACATTTAAGACAGTGAGGATGTGAATAAATATATTAATGCACT
TTGGCATTTGTGTTTTAAGTGATTAACTGCCAGAAACAGCTATTTCTAAAAAGTTATAAG
GGAGGAGGGGTTCTTTTTTGATCAGTATTCACTGCTGTCACCATAATTAATAGCCTTAAA
ATAGCTTGTGTTTGGCCCAAAGAGAAATGTACTTTCTTCCAGTGACTCAAAAATCGTGGC
TAGAACTAGACTGATTTCTAGTGACAGGTGTGCTTTACTGCACTCAATGCGTATTTTTCC
TCCAACTAAATTGTACATTTAATGTTGCCATATCTTCTGCCTTTGCTTTGCAGGAAACGA
CAAATAATGTATAGAGGTATTCAAAAAATTTATTGAAAGCACTGTACTAGGAGCTGAGAA
CACGATGATGAGCACAACACAGTTCTTCCCTTTGGAAACATAGATAAGTGGAGGGAATGT
CATCACAAATGTAAAACTTCACTATGAGATGAGTTCCGTGATAGGATTTTCTTAGGGAAA
CCTGAGAAAGAGTTGAGACTAAAGGTATGTGTCATATTTTTCACAAGGCAAAACTGGGGG
AATGACATATACAGAGGCTTGGGCTAGAAAAAAGATACCGTTAGTCCACTTACTTTTGAG
ACAGTTTTGGCTGCTTTCCCTCTTCAGTGCCCTGTTTTAGAACTGAGTCCTTACTGAGGC
TTGTAAGATGGCTATTATGGGAGGTGAGAGTGTTACAAAATGAGGCTGAAGAGGTAGGTA
AAGAAGCCAGACCACTTCAGGCTCCCTCTGGCTTTATTAAAGCAAGATAAATCCATGGTG
GAAAATCAGATTTGCAAGAAAAGGTAGTTGAACTAGGTTGCTTATTGTTGTCTAGACAAG
AGACCAGCTTGGACTAGTAAAATTAGTGAAATAAGATCGTTTATAGTTGGATGACAGAGC
CAACTAGACGTGGTAATAGTGGAGGTGTCCATAACTGCTAGGTGTCCAGCTTGCACACTG
ATGAGCATAATGACCCTAGATTCAGCTGGGGAGCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1445, 1853..1925, 2301..2457
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved