Homo_sapiens Locus Mono:95:U3.41-201
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:95:U3.41-201
Homo_sapiens
Mono:95:U3.41-201
6
U3.41-201
1001..1213
2212
GAGGCCAAGGTGGGCAGATTACTTAAAGTCAGGAGTTCGAGACCAGCGTGGCCAACATG
GTGAAACCCCATCTCTAATAAAAATACAAAAATTAGCTGGGTGTGGTGGCATGCGCCGGT
AATTCCAGCTACTTGGGAGGCTGAGGCAGAATAATCACCTAAACCCAGGAGGCGGAGGTT
GCAGTGAGCTGAGATGATGCCACTGCACTCCAGCCTGGATGAGGGAGTGAGATTCTATCT
CAAAAAATAAAAATCAAAAACAAAAACAAAAAAACAAGCCTATTCTATTGGGGCCGAGGG
GGAGGAAAAAACAGCTTAAAGTTATCAGAATATAACAGAAAATTATTTTTTCAATGTACA
CCATATTTAAAGAAAAGTAAAATTGTAGAAGTAAAAGATGTAGTAACTAGAATTTTAAAA
ATCAGTGAATGAATGTGGCAGCAGATTAGTCATAAAATAAGAGAGAATTAGTAAATTAGA
AGCTGAGCCAGAAGAATTCGGAAAATAGCACAGAGAGAAAAAAATAGATGGAAAATATAA
GAAAGAGGCTAAGAGATATAAATGAAAGTTAGATTATTTAAAATACATTTAACTTCAGCT
TGGAAACAGAAAAGGCCAAAAAATATTTAAAGAGAAAACAAGAACATACAACAGGTCCAA
AGAAAACATCCATCAAATTCCAAGTACGTTAAAGAAAGATAAATCCAAACGTTGAAATAT
TTTAGTGAAATTACAGAAAATAAAGGACAAAGAGAAAACAATGCCAAGAATAGCTAGAGA
AAGACAATAGTGAGTATGAGATTGATATAGAATTATAAAGACCAAGTAAAGATATATCAT
GCAAATATTAATCTCAAAAAAGTTGATATCAGATAAATGTTTTGGAAGAAGTAAATAGAG
TCTTGTAACAATATAAAGTTTTTAACTCATCAGAATAGTACGAGCTGAATTCATATATTT
TGAAATACACAGCCTTAAGATGAATAAAGAAAGAATATACAAAGACTCCTTTCAGGAATC
ATTTCTTTAGTTCCTACTAGAGAGGCTTCTCTTAACATGTGGAGCGCTGGAAACCACAAA
GAGGAGGTGCAGCATTCAGTTCTAAGTGTGAAGTGGATTCTTGGTGTTGCTGTGCTGCAA
CTGCCATTTGCTAATGATGACCTTGCTTTTCTTACTTAGAGTAAGACAGAGAGACAGCAG
TCAGCCTAAGCGGTTTCCATTTATGAAAGCAAAAAACAAAAACAAAACCACTCTAAATTT
GCAAACCAAAATAGACTGTAATCAGAGTGGAAAATTTTAACATACCTCTCAGTAATTAAC
AAAACAACCAGACAAAAACAACAGTGAGTTTATAGTAGGCATGAACATACAAACACAACC
ACAATAATAGAATAATAAACTTTATTTTTTAGCACACCTGGACCACTTACAAAAATTGAT
TTTGTACTTGACTATAAAATCTCAACAATTATTGGAAGACTGATACAGTATAATAGTCTC
TCATCACAAAACAATTAAGCTAGAAATAATGAAATAACTTTAAAACATTTCCTGTAGTTA
GAAATTTAAAATTGTATTTGAAAGTACTCATGAAAAAACACTTTTTAAAAAAACAGAAAT
TAGAAAATACTTTCATCTAAACTTTTCTCTTTTTTTCTTTTTTTTTATTATGCTTTAAGT
TCTAGGGTACACGTGCACAACGTGCAGGTTTGTTACATACGTATACATGTGCCGTGTTGG
TTTGCTGCACCCATTAACTCGTCATTTACATTAGATATATCTCCTAATGCTATCCCTCCC
CCCTCCCCACACCCCATGACAGGCCCCGGTGTGTGATGTTCCCATCTTTTCTAATCCTTG
TAAATGCAGCTAAAACCATATTTAGGGGAAAATTTAAAATCTTAAACAATACATTATAGA
GAAAGAAGCCTGAAAACTAATGAGGTAAGGATCCATCTCAAGAAGTTAGAAAAATTATAA
CAAATAAACCCAAGAAAATAGAATGAAGAAAAACTTTATTAAGAGCAGAAAGTGATGAAA
CAAACAAATACTATGGAAAGGATCAATAGAACACAAATTTTATTTTTGGATATTGTTAAT
AAAATTGTCTAACTTGACAGAAACTAAATTAGAAAAAAAAAGAGATGAGTAAGCAATATC
AGCAATGAAATAGAGCACACAACTGCAAATGCTACAGACATTTAAAGAACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved