Homo_sapiens Locus Mono:11:AL607035.12
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:11:AL607035.12
Homo_sapiens
Mono:11:AL607035.12
10
SNORA36CL2
1001..1132
2132
AAAATGCATGAACAGCAGCTTTATTCATAATATCCCATAAGTGGAAACAATCCAAATGT
TCCAGTGGTGAAACTCAACTATTTTTAAAAAAACATAAAAATACTAATGACAGAAAAGAA
AAATACTTTAAAAGAACCGGCCGGGTACGGTGGCTCACACCTGTAATCTCGGCATTTTAG
GAGGCCAAGGCAGGTGGATCACTTGAGGTCAGGAGTTTGAAACCAGCCTGGCCAACATGG
TGAAACCCCATCTCTACTAAAAATATACAAAAATTAGCCAGGCATGTTGGCACATGCCTA
TAATTCCAGCTAACCAGGAGGCTGAGGCATAAGAACTGCTTGAACCCAGGGAGCAGAGGT
TGCAGTAAGCCAAGGTTGTGCCACTGCACTCCAGCCTGGGCAACAGAGCGAGACCCCGTC
TTAAAAAGAAAAAAAGAAAAAAAAAAGAACCAAATGGAACTTCAAGAGATAAAAAAATAA
AAGAGCTACCCAGGCACGGTGGATCACACCTGTAATCCCAGCACTTTGGTAGGCCTAGGC
AGGCAGATCACTTGAGGCCAGGAGTTCAGGACCAGTCTTACAAATATGGTGAAACCTTGT
CTCTACTAAAAATACAAAAATTAGCCAAGTGTGGTGGTGTGTGCCTGTAATCCCAGCTAC
TCAGGTGGCTGAGGCACAAGAATCACTTGAACTCAGGAGGCGGAGGTTGCAGTGAGCCAA
GATCGCACCACTGCATTCCAGCCTGAGCAACAGAATGAGACTCTGTCTCAAAAAATATAT
AAAAATCAAAAATCAAAATTGATAATTCCATCAAATGGGATTAACAAAAGATTAGACACT
TCAAAAAAAAAAATCAGTGAACTTGAAGACACATCTATAGAAACTATACAACCTGAAGCA
GCCTGGGTGAGGGGATCAGTCATACCCAAACCTCAGCATTATAAAATATACCCATGTAAC
AAGCCTATACATGTACCTCCTGAATCTAAAATAGAAGCTGATTCCAAAGAATTGAGTTCA
GTTCAAGGCAGCTTCCCTGTTCTGTTAACGAAACTTTGGGACATTGAAATGGGCTACGGG
AGATGATTGGTTCAAAAGCATTATTCTATTCATTTGCCTTTTTTTTTGGAGACAGAGTCT
CACTCTGTCACCAGGCTAGAGTGCGGTGGCACGATCTTGGCTCACTGCAACCTCCACCTC
CCTGGTTCAAGCAATTCTCCTGCCTCAGCTTCCCGAGTAGCTGGGACTACAGGCACGCAC
CACCACGCCCAGCTAATTTTTGTATTTTTAGTGGAGACAGGGTTTTACCACGTTGGCCAG
GATGGTCTCGATCTCTTGACCTTGTGATCCACCTGCCTCAGCCTCCCAAAGTGCTGGGAT
TACAGGTGTGAGCCACCGCGCCCGGCCTATTTGCCTCTCATCTTACAAAAATGCCTGCTT
GAGTCTAATATATCAACAGTTAAAGATGCCTAGAAGAGATGGGACTGAAGAGGCTGAAGA
CTTACTGAGCTTGGACTAACAGACAAGTTACATTCAGTTTTAGGAAGTCTGGTCTGATGA
ACTAAGATAAAAAGAAACTGAATTATTTTCATACATGGTTGCTTTTCAGAAATAAAAACA
AAATAGAAGCTGAAATTTAAAAAACAAACAGATTTTAACATTATAAAATTGGAAAAACAA
AAATTTTGAACAATAAAGGAATATTTAATTTTTTTCTTTTTTTTTCATGAACCATACATG
AGACTTAAGGAATATTTAACTATTTTTGGAAAACTGAAGCAGAGAAAAAAAAACGTCTGG
ACAGAATCTCAGTAACTTGTGCACCAATATCAAGTGATTTTTTTTTTCTGAGATGGTCTC
ACTCTGTTGCCCAGGCTGGAGTGCAGTGGCACCATCTCAGCTCATTGCAACCTTCACCTC
CCGGGTTCAAGCGATTCTTGTGCCTCAGCCTCCCGAGTACCTGGGATTATAAACGTGTGC
CACCACACCCAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAG
GGTGGTCTCAAACTCCTGACCTCAAGCGATCCACTCACCTCAGCCTCCCAAAGTGCTGGG
ATTACAGGTGTGAGCCACCGCACCCGGCCTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved