Homo_sapiens Locus Mono:40:AC013722.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:40:AC013722.8
Homo_sapiens
Mono:40:AC013722.8
2
SNORD89
1001..1114
2114
AATACTGTGACAGACCAAGGTAAATTGTTTTTGATAATTACAGAAGTGTGATTTCTTAA
TCAGCAGCTGTCAAACATAGTGTTCCTTAATTTAAAAGCTTGAACACTAAATTATAAATT
GGAGAGGTTGGAATAATTACGGTCATATCTCTAGAAACACAAGTCTTTAGTAGCAAAAAA
GAAATTAGCAAGAGAAGAAAACTGTTCAGTACTTTGAAAGGAAAAAGTTTTCAGTGATAG
TTTTTTTAGATGAAAATTAACATGATAAAGAAGTGACAGGCCAGGTGTGGTGGTTGACGC
TTTTAACACCAACAATTTGGGAGGCCAAGATGGGAGGATCTCTTGAGCCCAGGAATTCAA
GACTAGCCTAGGCAACAAGGCAAAACTCATCTCTACTAAAAATTTAAAAAATTAGCCAGG
TGTGGTGGCATCTGCCTGTAGTCCCAGCTGCTTGGGAAGCTGAGGTGGGAGGATCGCTTG
AGCCCAAGAGGTTGAGGCTGCAGTGAGCTGTGATCACACCACTGTACTCCAGCCTGGGCA
AGAGTGAGACCCTGTCAAAAAAAAAAAAAAAAAAGAAACAAATATTACAAGAGTTTTTGC
TGAAAGTTTTAAGTTGATAAGATGCAGAGAATTGGGGGAATGTATAATAAATCAGGTTTC
ATTGTTATATTATTTACCACATGAATCACCTTCCTCCTAACCATTATAGGAGCCATGTGT
TCACATGTCATGTGGACCAGTATTTAACTGTGGAAACCGCGGGTGGCATGGAGAAGGAGG
CAGTGTCCGTGACTGTGCTGCTCTCCGCAGCCCCCTGCCTGCTGTCCTGTTTCCTCGGCT
CCTCGGTGTCTGGACTGGCGTTCTGGGTTTCCCAGCAGAAAACTAAAGGGCCAGAGAGGT
GTAAAAACACACACCACTTGGCAGGTAATAATTTCCCCGCATGCTATCTTTTTAGGGATC
CTGAACACACAGCCTTTCCCAGAAGACTGCTCCCTCCAGCTACTGAGGAATGATGACAAG
AAAAGGCCGAATTGCAGTGTCTCCATCAGCAGTTTGCTCTCCATGGGCACACGATGACAA
AATATCCTGAAGCGAACCACTAGTCTGACCTCAGTAGCAGGATTGGAAGCTTCATGCCAT
GGGAGCTGTCAAGAAAGGCATCCCAAAGAGAACTGAAATTTAAAAATAATAATAGACCTT
CAGGAATAGGTGATTGTCCCCATATACTGGGGATGAAATACCCAATGTAACCAAATTCCC
CAGTAAGATCACTTAGTTTGGCAATAGTCTTTTCTTTTGAGCATGTTGAAGTTTATTTGC
TCAATGAAGGCTGAAATTATAAGTCAGTATATATGTATTACTAAGTAGAACTTGAGGTAA
TTATATGTTTTAGTCAAAAGCAGTTTCTGTGGGCTTGGTATAAACCCTACTTTGTGATTT
GCTAAAGCACAGGATGTTGACTCAAACCAAAACTAGTTTTGTAGTTAATATGTGTTGTGT
TTCTGTGACTTAATAGTCAACTAGAAACGCCACCTACAACAACCCAGGTACTTAAGTTTT
AAAAGTTTTTTTTAAAACACTTGTCACCATATTTTGAAAAATACTAACATTTGGATTACT
AGTTATAAAAGTGTAATTTCTACTGTGTCATAATCAGCCATGCAGCTGGAGACTTGCCCT
CTTTGTACAGCAAAGTTGTGAAAAAAAGTATTTGCACTACATTTATTTAAACATTAGGAA
AAAAAGCCAACCCATGCTTTTCTTTGCCGAGATGTAGGGCTGTATTATTGGCTAGTGAGA
AGCCTGGGAACACTAGGACTTTGTGTGGGCTGATTGCAGGTATCAGATCCGGGATTATAC
AGGTACTGTTGGAAGTATCTTGGGGATTTTCCTGATAAGAACAGTAGTGATTGCATAAAA
AGGACAGGATGTAAAGTGAAATCAGTAAAATATCTTAGTAGACAGAGGGTGCTGAAATTT
TAACAAATGTGTAAAAAGTTCTTCCTATGCATTAATTTTCCAGATACCCTTAAAATGTTT
AAGGAATGTAATTCAAAATACTGTTTAAAAGAGACATGTGACCATCATTCTCCCAGCGAA
TGTGAATCATTTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved