Homo_sapiens Locus Mono:48:AC096587.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:48:AC096587.1
Homo_sapiens
Mono:48:AC096587.1
2
SNORA43L4
1001..1138
2138
CCTTTAACAGCACCCTTCCTGGGCTTTGAAATGCACTGCACAGGTGCAACAATTCAATT
CACAAACAAAAATTGGTTTTATATTACCAGTGAGAAGGACTAAGCATAGCTATTTTGGGA
GTTGTAATACCTCCTTTAAGCCACAAAGATACTTGAGCACATTACCTTAACAACCAATGT
ATTCTGGAGATCATTTTAGAATATGAAATACTGAACAGCAGGAACGTTGTGAACATTTTC
AATCTTCTTACACAATATAAATGTAGTCTGAAAATCCCATTATACACAAGTACAACAAAT
ACATACAGACCCTTAAAATACAGGAAAGAATGTGAAAAATAAGTATTATCACCATTCCTC
AAGTTTCTAGAACAATTTTACTCTTCTCCTTAATATAATTTTTTGTCCAGAAAAGGGAAA
GACTAAACTCATGGATAGTTATCCAAAGGAGAGAAGAGAAAATTGTTTGTGGTAAATGAA
AGATGCTGCCTACAGTAGCACAAATAATCCCATTCATGGCTACCAGCTTGCTACGCATTG
CTTACTTATGCTGCAGGCAACTATTGTTGAAATGACAGGAGGACAGGAAGGCATGAGAAA
GGGGCAGACAGCTACTGATGAAAGAGTCATCAACTACTGTAGATACTTCTTGGAGATTGG
AAGTTGAATTTTACATTTCTTTATATCCCCAGGTTTAATAAAAAAATTGCTTGTAGGTGT
TCAATAAACATTTGATGAATGAATGGGGAACAGTTCAGTTATTTTCCTTGAATCCTAGGC
AGGATGATTTGATACACTTTGGATTCTTGAGGTTTTATGAAATTTTAAATGCAAGGCAAA
CTACTATTTACCCAATTGAAGTCCAAATGTAAGCATTTTATGGTAAACCAGGAGAAAGTA
GAAGGCAAAAATGCATTAGCTTAAAACCTAGGACACCAAAATGAAGATCAAATGTATGCA
TGAAAGTGTGTTAAAGAAAATCATTGCCCTGCCCTGCAGATGCTATCCTGGACTTGCCAG
CCCCATAGACACAGTTGCTGTGCTGTGCCTGTACTATTGGAGCAAAGAAAAAGTGGCTAT
TTCTATGCTCAGTGTTCACAAACCAGTGAGCACTAAGAATGGTTTATAGCCTGACATTTC
TTAGAAAAGAAGAAGAAGAAAACTGTTGCATAGTATCAGCTAAATTTGGACATAAATGTT
TCCTATGATTCAGTAATTCTTTTTTTTCTTTTTCTTTTTTTTTTTTTTTTTGAGGCACCA
TCTCGGCTCACTGCAACCTCCACCTCCTGGGTTCAAGCACTTCTCCTTCCTCAGCCTCCT
GAGTAGCTGAGATTACAGGCATCTGTCATCACACCTGGCTGATTTTTGTATTTCTTTTAG
ATACGGGGTTTTACCATGTTGGCCCAGCTGGTCTCAAACTCCTGACCTCATGATCCACCC
GCCTCAGCTTCCCAAAGTGCTGGGATTACAGGCGTGAGCCACTGTGCTTGACCTGATTCA
GCAATTCTACTCTTAGATATTTATTCAATAAAAATGTGCACACAGGTGCAACAAAAGAAA
TGCACAACAGCCAAAATTGAAAATAACCCAAACATTCAAATTTGTGTTATATTCATGCAA
TGGAATATACTATACAGTAATGAAAGTGATAAAACCACAGCTACATGCAATAACATGAAT
GTGTCTAACAAGCATATATGCTGAATACAGAAGTCAGACAAAGGAATGCACATTATACGA
TCCCATCTACACGAAGTTGTAAAACAGGCAAAACTAATAGAGTCAGAATAGTGGTTACCT
TTGAGAAGGAGAGTGGGGTAATGTTGAAGAAGGGATAAATGTTGGGAAAAAACTACTGGG
GTGTCAGTAATATTCTCTTCTCAGACATAAGTGTTGGTTACACAAGTGTATTCATTTTAC
ATTGAATTGTGAATCCTTAGGATTTGTACACCTTCTGTTCAGTAGAAATAGCAAAAGAAG
CTATCTAAAAGTCTCCTAGAATAACCTTTGCTTTTGACCTTCTTTTCAACTCAAATACAG
CTGAAATTGTTGCCTCATCTTAACTGTAGACAAAGATGCATGAAGTGGGAGATTATAACA
TGGCCACAAATTTCTCTAATTCCTCTTATCATCAAGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved