Homo_sapiens Locus Mono:308:AF064863.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:308:AF064863.3
Homo_sapiens
Mono:308:AF064863.3
21
SNORA51L12
1001..1136
2136
GTAGCAGTGATCTTTCCCTTCCAATTATGCATGATTCAGCGATTACACATAAGAAGAAA
TTCCCTTGCCCATCTTATCCTGAGTGAACCTTGTTCTTTCTTACAAAACTGAGTCTATTT
TCTTTCATATCTGTTATTCCACAAACACTGACTTCACACCTACTCTGGGAAGTCACCCCA
CTGCACACTGGGGATACAACAGCAAGGACAGAGGTAGGTTTACTCTCCTACTAAATCTTA
TCTCTATTACTTCACGTCATTGGAAATTATGGGTATCTTGTGATGTTCTGGACTCTAAAA
TGTCAGAGACATGTGAATGAAGGAGCGAAACGTGGTGATCCTCAAAGCCTGTAGGAGAAG
TGGGAGAGGAGAGAGTGGGAGGCTGTCTTCACGTTTGCGGCATTGTTCTGTCTCCATCTA
TTGCCAAGGGCCAGTAGAGGTCAGAATATTCTTAGCAGATTATTGACTTCTGATTATTTG
ATTAATCAATGATAGAAACTGTTGTCCATTTGTCGATTTGTACCGTTGCTCAGTGAAGTT
ATCATAGTAAAGTTATAGTACTGTATAGTTATGCGCCATAAGAGTAACAGTGCTCTGACC
TCCCTCGTTCACACCTGGGCAAGGCCTCCCCCGAGACCCATTAACGGCACAACTGCGTCC
CTAGTGGCCATTCCCAGAACTGCAGGGGAGGGAAGGGACCATAGAAAATTCTCAGCTTCG
ACGCTTGCCCATTTCCTCCACTAATTTTTATTTTTATTTATTTATTTATTTTTTGAGACA
GAGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAATGGTGCAATCTCTGCTCACCGCAACC
TCCGCCTCCCGTATTCAAGCGATTCTCCTACCTCAGCCTCCCGTGTAGCTGGTATTACAG
GCACGTGCCACCACGCCCTGCTAATTTGTTGTATTTTTAGTAGAGACGGTGTTTCTCCAT
GTTGGTCAGGCTGGTCTTGAACTCCCGACCTCGGGTAATCCGCCCGCCTTGGCCTCCCAA
AGTGCTGGGATTCTTACATCGACTGCATAGAAAGAGGAGAGAACATAACCTACCTACCCC
GTACATACTTCAGCCCAGGTCCTGTGCCTCATCTGTAATATGAATGAAGAGACATGGAGA
ACAGAAAAGAAAAAAAGAAAGGAAAATCTATCTTGGGAACAACAACAACAAAATCTAAGA
ACACAACTATGCATATATGTCTTAGTCTGTTTGGTGCTGCTGTAAGGGAATACATGAGGC
TGGATAATTTACAAAGAAAAGATTGATTTGGCTTATGGTTCTGTAGGTTGTACAAGAAGC
ATGGCACCAACATCTGCTTCTGGTGAGTGCCTCAGGGAGCTTCAAATCATGGTGGAAGGT
GAAAAGGGAGCAGGTGGGTCACCCAACCAGAGAAGGAGCAAGAGTGATGGCAGGAAGTGT
CAGGCTCTCTTAAATAGCCAGCTCTTGCATAAACTAGTAGAAAAAGAACTCGCTCATTAT
CACAGGGACGGCACCAAGCTATACATGAGGAATCTTTCCCCATGACCCAAACACCTTCCA
CTATGCCCCACCTTCAACATTAGGGGCCAAATTTCAATATGAGATTTGTAGGGACAAATA
TCCAAACTATGTCAACATGGTGTTGAATGAATGGACAGAATAAAAGCAAAATAACATATT
AGAGAGAGAATTTAAAAATAAAAAAACTGTATGTAACAACAACAACAACAACAAAAACAA
GTGAAGTCAAAAATAGTCAAAATACCCTCCAGGCACCAGATCACAGATTGGGACAGAAAA
CAGAAAGGCACTTCATTAATTTTCAAGGCTTTGCACTCAAAACTGCTACATAAGCAATGC
AGTGACAGATTGCATACAGAATTCATAAGGAACCTCCAAGGCCATTTGTGTGATCAGGAC
AGACAACCTGGGCATGAACTTGAAGGCACACATTTTTCGTCAAAAATGTGCCAAAATGAA
AGCAACCTCCCAAAACAATTTAAGAGAAACAGTGGCAAGTGCAAAGAAAACTGGACAGGT
ATGGTGAACCCTACTCCTTATTCCCAAAGAAGTATAGGAAAGCTGTTGCAGAGCCCTGCA
TGCTCAATTTACAATTCCTGGATCAACGTTTTTCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved