Homo_sapiens Locus Mono:139:AL158154.28
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:139:AL158154.28
Homo_sapiens
Mono:139:AL158154.28
9
SNORD95L1
1001..1068
2068
ATTGAGATAGGAATTCTTAGGCAAGTAATTTAGTGAGGGAATGCTGCAAAGGTAGGAGG
GATACAGTATAAGGTAGGGGAAGAAGCAAGGCAATGATGTGATTTGATGGGGCACTATGG
AGAGTGAATTATACCCATACAGGTTATTCTCCCCATCAGCAAAGGTGCTGGGCTGTGATA
TCCCTGCCACCACCAGTGATTGGCTATGGACCACCCTGAGAGCAGGGATGAGTGAAAGTC
CATGCAGACTCTCCAGCTTCTCCAGGCCAAGTGTATGAGCATGTGTACTGGTGAACACAG
CTGTGTGATGACTTTTGTGTGCTCTGGGCACTTTTGCCTTCTAAGGGCTCCTTCCTTCAT
TAAACAATATATTAAAAATTAGGGTGGTGGGGCCAGGCACGGTGGCTCATACCAGTAATC
CCAGCACTTTGGGAGGCCGAGGTGGGTGGAGCATGAGGTCAGGAGATGGAGATCATCCTG
GCTAACATGATGAAACCCTGTCTCTACTAAAAAAGTACAAAAAACTTAGCCAGGCGTGGT
GGCGAACACCTGTAGTCCCAGCTACTCGGGAAGCTGAGGCAAGAGAATGGCGTGAACGTG
GAAGGAGGAGCTTGCAGTGACCCCAGACAGCATCACTGCACTCCAGCCTGGGCTACAGAG
CGAGACTCCGTCACACACACACAAAAAAAATTAGGGTGGTGGGCTGGGCATGGTGGCTCA
CACCTGTAATTCCAGCGCTTTGGAGGCCGAGGTGAGCACATCACCTGAGGTCAGGAGTTC
GAGATCAGCCTGGCCAACATGGTGAATCCCCATCTGTACTAAAAATACAAAATTAGCCAG
GAGTGGTGGTGCGAGCCTGTAATCCCAGCTACTTGGGAGGCTGAGACAGGAGAATTGCTT
AACCCAGGAGGCAGAGGTTGCAGTGAACCGAGATAGCACTACTGCACTCCAGCCTGGGCA
ATAAGAGTGAAACTCCATCTCAAAAAAAAAAAAAAAAAATTCGGGTGGTGATGACCCCAA
CATTCCATCTGAATGCCTGTGCTGAAACCCAGAGGCTGTTTCTGAACCACTGCATAAAAA
AGCATTAAAATTAAATTTTATGACTGCATTGATATACATATGAATATAATCCAGGTTGGA
ATATATTTGTTTATTTATTTTTAGATTTTGAAAGAGATTAAAACATTTTCATGGGTTTCT
AAAAGTATCATGGGAACTTGGCATTGTGCCTACTGTGTGTAATGGATAAACTGACCCTGT
TAGTGAAGTTGGAATCCTGTGGAGAGCCAGCCCTGTGTGGTTCAGGGATGCTGGGGTGCC
AAGTGTGTAGCTGGTTCTGTGTCTGGTCTTTGCTTCCATTTCCTACCTGCCTGGATTCCA
ACTAAACCTATTACCTTCTTTTTCTAAAGTCCCTGCTCTACTGAGACTGTACTGGGTTGA
ACAACAGTGTCCCCCCAAAATTTATGTCCTCCTGGAACCTCAGGATGTGTCTTATTTAGA
AATATAATCCTTGTAGATATAATTAGTTAAATTTAGGTGAATGTCCTGAATTAGGGCCCT
AAATTAAATGACTGGTGTCCTTGGAAGTGGGGAGAACACAGAGGGAGGGCAACGTCACAG
CCATTGACTATGGAGGCAGAGATTGGGGTGATACAGCCAGAAGCCAAGGAAAGCCAAGTT
TCCCAGCAATTACCAGAAGCTAGAAGAGAGGCATGGAACAGTTTCTTCTTTAGAGCCTTC
AGAGGGAGCATGCGCCTGCTGACACCTTGATGCTGAATTTCTAGCCTCCAGAATGATGAG
AGAATACTTTTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCCAGGCTGGAGT
GCAGTGGTGTGATGTCGGCTCACTGCAACCTCCGCCTCCCAGGTTCACGCCATTCTCCTG
CCTCAGCCTCCTGAGTAGCTAGGACTACAGGCGCCCGCCATCACGCCCGGGTAATTTTTT
GTATTTTTAGTAGAGACGGGGTTTTACCGTGTTAGCCAGGATGGTCTCAATCTCCTGACC
TCATGATCCGCCTGCCTCGGTCTCCCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved