Homo_sapiens Locus Mono:252:AC018474.31
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:252:AC018474.31
Homo_sapiens
Mono:252:AC018474.31
12
SNORD81L4
1001..1076
2076
AAAGTTTTGACCAAGAGAACGGAGACACATCATTTTCTTTCTTCATTTACTTCAATAAT
ACTTTAGAACTTTAAGAATGTAAAGAATCTATGAAATTACAACATGGAGGTCTTCAGTCG
AATAGAAGGCACCATTTGCTGTTGGTGAGAGTTTTTAACATGGGTTAGAGAGTTGACAGA
AATTTTAAATCCTCTAGTGAAGTCTTTCGAAATATGACAGATTCATTTTTTCCAATTGGC
TAGAGTTACTCAGTTGTAATATCTCCAAATCCGTTCCCATCCTCTTCAAATTCTTCTAGC
TCAATTTGCTGTTTGGCAAAGTTTGTTAATTTCTCCAAAAGTGAGTTTTCAGCTTAAGGG
AGGATTAGTTGGAGAATAATTCTTCCTATTTCTTATGTTTTGTGGTCAGAGGAAAAGTTG
GCTATCCTTCAAATCCATTGAAATCCATCACAATCAAAAGAAACATTGGCAAGTGGTTGT
GTTTCTCAATACTTCTTGTACATTTTTGGGGGGATGTATCTCATAAAAACAATTCTTTCA
TTGCTCATGGTCTTAATTTTTTTCCCCAGTCCATAGATAAACTGAGATAAAAAATCAGCC
AGGGATTAGGGAACATCATGCAACTGGTGACACTGTGCAGAAGATCCAGACTCAACCAAA
ATAAAAGATAACCTGGATCCACACAGTGTTTTCCTTTCATTCAGCTACCAATATAAAATG
ATTTGCACATTTTTTCAAAATGATGCTTAATTCAAAGTAGGAGTTCATGTAAGTTCAAAT
GTAGGCTTCCTTTTTGTGAAGGACAGATGCAATCATTCAATGTCCAACTCGGATCCCTAT
CTTTCATCTTATCTGATTCTGTTGTTCTTAGGGATAGCTGTCCTTATGTGCAGTCATGAT
GAATCTTTCTCTGGGGGATACTTGTTCAAATGGCAGGGGGAAAAATGCAAAATGGACGGG
AGAGCAGAAACTGAAGTTTTTTTTTAACAGAAAGTTATGAGCAGGTAAAACAGGCCTTTA
GAACTATTATCCAGGACTCACTGATTACTTGATGACAATAAAATATCTGATAGCCTATGT
TCATCAGGTATCATTTAAATTGAAATCTGGAAACGTTAAGGGTGGTCTTTGTTGTAGGCA
GCTTGATGGATACTTATGGGATAGATTAAACATGTCTTTCAATTTTAATAAATTTCTTCA
AACCAGAAAAAAAAAAAAAGCTATTACCCAGTACAATGGGAGAAACTGAAAGTGACAGAA
GTGGGATTCAGAGTCTAGTGAAAACCACTCTAAAAGTCATAAAATCACAAATCGAGTGGT
CATTGAAAAGAGACAGAAGGTGCTTTATTATGCATGCATCAAACTTATAGTTATTTTCTA
AAACTAAGAGGGAAAGAGAGCTTTGGAGTTTGAGGTAAGACTTTGCCATTTACTTAGCAA
GTTATTTAACCTCTTTATGTTGAATTTCTTTATGGGTAAAATGAAGATGATAATAGTATC
TATTCATAGGGTCGATGAAAGGATTAAATGCAGTAATGTATATAAACACTTAATGTGTTG
CTCTGAGCATAGTAAGAGCTTAATAGATATTAGCCATTATTACACTTAAAAAGTATTTAG
CGAAGAAGCAACTGTAGATGTAAACGAAATGCAAAATACCTGTAATGACCCATCTAACAT
GTATAAAATGTCTAAATAGTCTCTTTATAAAGTGTGCTGCCTTTATAGTTTCCTTTTAAA
GAAGGTGAAAGTATTCAAAGGGTAAATATTTGTAAGATATTTATATAATAATGACAGAGA
CAGGAGGCAGCCGAATGCCACCCAGGTCACACAGGGAGCTTGCCTAAACATGCCTGCAGT
GAAAAATTCCATCCCTTAACACATGTGCAGTAAAGAAAATAAGTCAAGGTGGAGTTGCTC
AGACTATGGGCCCGCATGCGCACTGGAAGAATGGGGGGTGGGGCCACCAGGAATTCATGC
CTTATGCAGTGGGAGGAGCCAGGCCTCTTGAGCTTATGTGTGGAGCTCATGTGCGGTGGC
CTGGTATTCAATCTGCGAGGTGGGATCCTGTTGGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved