Homo_sapiens Locus Mono:281:AL355836.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:281:AL355836.3
Homo_sapiens
Mono:281:AL355836.3
14
SNORD3@L23
1001..1215
2215
TTTTTTTGTAGAAACTGACAAGCTAGTTCTAAAATTCATATGCAATTCAAGGTATTCAA
AATAGCAAAAATAATCTTTAAAAAGAAAACCAAAGTAGAAAGACTCACACTTCCTGACTT
CAAAACCTACTACAAAGCAAGAATAATTACTATAGTACAGTACTGGAAGAAGGGTAGATA
AATAGATTAATGGAATAGAATTGAGAGTACAGAAATAAACCCACATTTCTAGGGTAAACT
GATTTTTGACAAGAATCCAAGTCCACCCACTGGAGAAAGAATGGTCTTTTGACAAATGGT
GCTAAGACAACTAGAGATCCACACACAAAAATAATGAAATTGGACCCTTACCTCACACTG
TATTCAAAAGTTAACTCAAAATGGATCAAATTTCTAAATGTGAAAACTGGAACTACAGAA
TTCTAGAAGGAAACAGAAGGGGTAAAATCTTCATAATCTTTGATTTGGCAATGGATCTTA
GATATAACATCAAAAGCACAAGCAACCAAAGTAAAACCAGACATATCAGACTTCATCAAA
ATTAATTTTTTTTGTTTGTTTGTTTTTCCAAAGGACACTATTAAGGAAGAGAAAAGACAA
CACACAGAATGGTAGAAAATATTTGCAAATCATATACCTGATAAAAATTTGTAATAGCCA
AAAGGTGGAAGCAATCCAAATGCCCACCAACTAATGAATGGATAAACAAAATGTGGTATA
TCCATATAATGGAATATTATTTGGCCATAAAAAGAAATTAAGTATTGATATATGCTATGA
TATGGGTAAACCTTGAAAAAAGTATGCTAAGTAAAGAAAGCCAGTCACAAGAGGCCACAA
ATTATATAATTCCATTTATATGAAATGTCCACAATTGGAAAATTTATAGAGACAGATAGT
ACATTAGTAGTTGCTTAGGCCTGGGAGGAAGAGCATATGGAAAGTAGGAGGATGATAGTT
AAAGAATACAAGTTTCTTTCTGAAGTAATAAAAATGTTCTGAAGACTATACTTTCAGGGA
TCATTTCTATAGTTCATTACTAGAGAAGTTTCTCTGAATGTGTAGAGCACCAGAAACTAT
GAGGAGGAGGCACAGAGTTCTCTCCTGAGCATGAAGCTGGCACTTGGTGTTGCTTTGCTG
CAGCTGCCACTTACCATTGGTGATTGTTCTTGTCTTCCTCTTGGAGAGTAAGAGAAAGAG
AATGCAGTCTGAGAGGTTCTTGTTTTCACCAAAAAAAAAAAAATTCTGAACTTTATTGTG
GTGCTGGTTGCACTTATTTGTAAATATATTAAAGACCACTGAACCTGAACTTTTTTAATG
GATCCATTTTATATTATATGAAATATATCTCAATAAAACTTTTTTTTTAAAGAAGATGGA
TGTAGATGTGTGGCATTATTTCTGAGGCCTCTGTTCTGTTCCATTGGTCTATATATCCAT
TTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTATTGTATAGTTTGAAGTCAG
GTAGCGTGATGCCTCCAGCTTTGTTCTTTTTGCTTAGGATTGTCTTGGCTATATGGGCTC
TGTTTTGGTTCCATATGAAATTTAAAGTAGTTTTTTTCTAATTATGTGAAGAAAGCCAAT
GGTAGTTTGATGGGGATAGCATTGAATCTATAAATTACTTTGGGCAGTATGGCCGTTTTC
ACCATATTGATTTTTTCTATCCATGAGCATAGAATGTTCTTCCATTGGTGTCCTCTCATT
TCATTGAGCAGTATTTTGTAGTTCTCTTTGAAGAGGTCCTTCACATCACTTGTAAGTGGT
ATTCCTAGGTATTTTATTCTCTTTGTAGCAATTGTGAATGGTAGTTCACTTATGATTTGG
TTCTCTATTATTGGTGTATAGGAATGTTTGTGATTTTTGCACATTGATTTTGTATCCTGA
GACTTTGCTGAAGTTGCTTATCAGCTTGAGATTTGGGGCTGAGACGATGGGGTTTTCTAA
ATATACAATCACGTCATCTGCAGAGACAATTTGACTTCCTCTCTTCCTATTTGAATACCC
TTTATTTCTTTCTCTTGCCTGAATCCCTTGGCCAGAACTTCCAATACTATGTTGAATAGG
AGTGGTGAGAGAGGCCATCCTTGTCTTGTGCTGGTTTTCAAAGGGAATGCTTCCAGCTTT
TGCCCATTCAGTATGATATTGGCTGTGAGTTTGTCATAAATAGCTCTTATTTTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved