Homo_sapiens Locus Mono:202:AC079169.32
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:202:AC079169.32
Homo_sapiens
Mono:202:AC079169.32
X
SNORA68L3
1001..1132
2132
GAGGCAGGAGAATCACTTGAACTGGGAAGGTGGAGGTTGCAGTGAGCCAAGATCACGCC
ACTATACTCCAGCCTGGGCAACAGAACGAGATTCTGAAAAAAACAAAACAAAACAAAACA
AAACCATAGAACAATCACCTAGAAATTAGAAGAGGCTAAGTGGGTGTGAAGTAGACCAGC
CAAAAGCTTAACAGTTCATCAGGGAAATAGATAGAGAGCCTAGAGTCAGTCATCCCTGGT
GGTCATGGAGACTGTGTGTGCCCAAGGCTGTGGCCTCTGAGGAAGACACCAGCGGCTCCA
CATTGCATGGGTACCTGGACTTCACCGAACTAGTCCAATCAAGTCACTAAACAAATAACA
AGCAAATACAACAGGTCCTGGAGGTAGGTAAGGGGGAATCAGTATCCAGAGTTGCTACCA
TAGTCTCTAAAATGTCATTTTCAACAACAAAAAAATTACAAGACATGCAAGAAAAAGGAA
AGTGTGACCAATACATAAGGAAAAAGCACACAATAGAAATTGCTTTTGAGGGGTCAATGG
GTTGAACTTAGCAAAACTTCAAAGCAGCTATTACAAATATATTCAAAAAACCAGGCGAAA
CCATGTTTAAAGGGTTGAAGGAGGCCGGGCAAAGTGGCTCATGTCTGTAATCCCAGCACT
TTGGGAGGCCCAGGTGAGCAGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAAC
ATGGTGAAAACCCGTCTCTACTAAAAATAGAAAAATTAGCTGGGTTTGGTGGTGTGGACC
TGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGATCACTTAAGCCTGGGAGGCAGAC
GTTGCAGTGAACCGAGATTGTGTGCCACTGCACTCTGGCCTGGGTGACAGAGTGGCACCC
TGTCATAAATAAATAATAATAATGCACTAAAGAAAAAAGTGTCAAAATTAATTGGTGTTA
CCCTCTGGGACAGCTGTCCCTTAAAAAAAAAAAAAGAATCACTTGCACCTAAACCCAAAG
AATCACTGTTTCTTGAAGTGGTGGTTTAAACAAGGTGCAAACAGCAAGCGAATCTCATTA
CTTTTGGTGGCTGTGGCCATGCTCCTTAAAGTGAACTTAGAGGCTCTACATCCCTGGTGG
CCAGTGCCTGCTGGGACCAGAGGCTGTGGCCATCTGGCCCCCCAGTCAGCCCCAAGTCAT
CGCCCCCAGGCAATGGCTGTGCCTGACAGAATGTACCAGGTCACTGGACAGGCACTCGAT
AGGAGGTTTGCCAAATGCCTAGAGTCCAGGAAATGCGGTTACCCTGCTCCCTCCCCCTTT
TTAGAGACCTAGACATGGGTGCCCAGCACCACACCCTGGCCCACTGGAGGAGATTACAGC
CAGCAAGTGCAGTTCCACAAATCCATCAAGTTCCTGCTGCTCCACCGCGTCCTGCACCAT
CAGCACAAGCCATGCTTCACTACCAAGAGGACCAACACCTTCTGCTAGTTGCAGGGGCCT
CTCACCCCAGTGTGCCCCATATAAACTCGGGTACGCCAAGAAAGAAAAAAAGAAAGGAAG
GAAGGAAGAGAGAGACAGAAAGAAAGAAAGAAAGAAACAATCAGTAAATTTGAAGATCAA
TAGAGATTATGCAATCTTAAGAACAGAGTGAGAAAAAGAATGAAGAAAAATTAGAAGCTT
CACAGAAATCTGGGACACCATTAACCACACACCAATATACATGTAATGGGAATACTAGAA
AAAGAAAAGGAGAAAGGAGAAGAGAAAATATTTGAAGAAAGAATGACTGAAAACCACAAA
ACATTGCTGAAATAAATTAAAGAAGGCTTAAATAAAAGGAGACATCCCATATTCTGAGAT
CAGAGAAGTTTACAGCATGAGCTCAGAAGATCAGACTGCCTAGGCTCAATCCTGACTCTT
AGGTAAGTTACCTAACTTCTTTGGGCTTTGGTTTTCTCATTTGTGAAATGAGGATAAGAA
GTCCTATATTATAGAGTTGTTCATGGAGTGAATGGCTCAATATACATATAAAGCACTTAG
AACAGTGCCTGTCACATGGTGTGTGTTTAAATGCTTTTTAGCTATCCTGAAATTGTGAAA
GACAATTTGGCAGAGTGTATGAATCTTCAGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved