Homo_sapiens Locus Mono:158:AL138701.16
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:158:AL138701.16
Homo_sapiens
Mono:158:AL138701.16
13
SNORA25L4
1001..1121
2121
CCTTATTTAATAAATGGTGCTGTGATAACTAGCTAGCCATATACAAGAAACTGAAACTG
GGCTTTTTCCTTGTACCATATACAAAAATCAACTCACGATGGATTAAAGACTTAAATGTA
AAACACCAGATTATAAAAACTGTAGAAGAAAACCTAGGCAGTACCACTTTGGACATAGGC
ACGGGCAAAGATTTTATGACAAAAAGGCCAAAAGCAATCGCAAAAAAGCAAAAATTGACA
AATGGGATCTAATCAACCTTCGCATTTTTTAAACTGCCACATCATGGTTGTATATATTTT
TGGGGTACATGTGATATTTTGACACAGGTATACAATGTGTAACTGTCAAGTCAGTCAGAA
TAATTGGGATTTCCATCACCTCAAAGGTTTATATTTCCTTTGTGTTGGGAACATTACTAT
TCTTTTCTTCTAGCCATTTTGAAATAGGCAATAAATTGTTGTTAATAATAATTTCCCTTT
CATACTACCAGATATTAGAACTTGCTCTTTCTATCCAGCTGTAGTTTTACAACCCTTAAC
CAACTTCTCTTCATCCGCTTTTCCCCTGTCCCTTTTCAGCCTCTGGTAACCACATTCTAG
TCTCTACCTCCATGAGATTCACTTTTTAATCTCCCACATATGCACGAGAGCATGCAATAT
TTGTCTTTCTGTGCCTGGATTATTTCATCCATATTCAATTTGTCCTCTAGTTCCATTCGT
ATGGCTGCAAATGAAAGGATTTCATTTTTTATGGCTGAATAATATCCAATTTTGCACATA
TCATACATTTTCTTTATCCGTTTATCTGCTGATGGACACTTAGGATCATCCCATCTCTTG
GCTTGGTTTATTGCAACACTATTCGTTATTGTGAGTAGTGTCGCAATAAACACAGAAGTG
CAGCATCTCTTCAATATACAGGTTTTCTTTCCTTTGGATAGACACCTAACAGTGGGATTG
CTAGATCATATGGTAGTTCTAGCTTTAGTTTTTTGAGGGGTAGGTCATTTCAAAGAAGGT
TCACGTGGCTGTGAGACCAAGAACGCTTAATGCTGTTACCAAAGATTGCAATAGGTTGTG
ATAGCCCTCAGTAGTGCTATGTTCCTCTGGGGAGATATTAATTAAAAAAACACACACACA
CAGAAAAAAGATGCCTAAACTTTTAAAAAACTATTGATAATGGGCCGAGTGCGGTGGCTC
AAGCCTGTAATCCCAGCACTTTGGGAGGCCGAAAGGGGCGGATCACAAGGTCAGGAGATC
GAGACGATCCTGACTAACACATTGAAACCCCGTCTCTACTAAAAATACAAAAAAATTAGC
CAGGCGTAGTGGCGGGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATGG
CGTGAACCCGGGAGGCGGAGCTTGCAGTGAGCCCAGATGGCGCCACTGCACTCCAGCCCG
GGCGGCTGAGCGAGACTCAGCCTCAAAAAAACAAAAAAGCTATTGATAATGAAGATTTGC
AACTTGGAAACCGGGTTATGAGAAAACAATATTTCCAAGTTTTATAAGGGCAGTTTATAT
AAATGTCTGAGTTAGACAGAAAGTAATTTCAGGGAAATATTTTCTACATTAAATAGCAAA
ATAATGTAGCTCTTGAATTTCTTCAACGTTACTTTAATTTAAACTATGCAAACCCGAAAT
TGTTCTAATTAAAGCCTGTCATTAACTTTGAAATCTCAACTTGGCGTAACAAATCTGGCA
CAAAGTGGTATTAAACATTTTTATACAGTCATAAATTTTCAAATTACTTTATTAGATGTT
TTTCACAAAAAAACAAAATGAGCTAAGGCAATAGATGAAGTGATCTGTATGATTTTTGTT
AAGTATATTATGCAATTGCAAAGGGCAATTTGTGTCATTTATTTTTCAATTAAGAAAGGA
CGTAAAATGTTTTTGTAGCTTCCAGGTGCAGAAAGGATTCTAGAATCTCTGCACTTGGCA
GAGGAGGAGGCGTTGGAAATGCATGTGGTGGGGAAGGTTGTGAAAATAAGTGCTGACATG
GAGTGGAGGGTCTCAAGTGTAAGGCCTGCCTTCCTGTTGTCTTTCGGCTTTTCAGCATAC
TTACACCCGATACTAATTTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved