Homo_sapiens Locus Mono:253:AC087893.15
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:253:AC087893.15
Homo_sapiens
Mono:253:AC087893.15
12
SNORA40L5
1001..1128
2128
TTGCCTTTAAATGGAAATTGTGCATCCTGAAGTACCTTGTTAAGAGTCCATTTTCAACC
TGAAATTCCTTTTTTTTGTAAACCACTTCAGCAAATACAGTGTGGCATTTACATTAGCAA
CCTCCCAGCCTAGGAGAGGATGCTCCAGCATCCGACTCTAAAAGACAAATTTGGGCACGG
TGGCTTGACGCCTGTTATCCCAACACCTTGAGAGGCCGAGGCAGGCAGATTGCTTGAGCC
CAGGAGTTCAAGACCAGCCCAGGTAACATGGTGAACCCCCATCTCTACCAATAATACAAA
AATTAGCCAGGCATGGTGGTGTGCCAGTGGTCCCAGCTACTTGAGTGGCTGAGGTGAAGG
ATCTCCTGAGCCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATCGAACCACTGCACTCCAG
CTTATGCAACAGAGCAAGACCGTGTCTCAAAAACAAATAAAAATAAAAGATTTTAAAAAG
ACAAATTATCCCACAAATGGTACATTGTGGTGGTGGTGGTGGTGGTGGTGGTAGACCTCC
CTCTTGCTCTTGAAATTGGATCAGAACAAACTGACAATGCTACCTACTTCATGGGGTCAT
TGGTGAATTCACTGATAATGCATGCAAATCCCCTTCTGCCTGGCACACTACCTAATAAAT
AAATGGTGGTTGTTATTGTTGGAATTGGAGGATATATTCCTAGTTGCAAGGGTTTCACAT
GTATTACCAAGTTAATCCTCACCGCAGATATGATTCTGTTTTACAGAGGAAGCAGTGGAT
GCTCAGAGAGGTTAGGTAACGTGGGTCAGGGACACACAGCCAGGAAGGGGCAGAGGCTGG
GAGTGCCTGACTCCAAATTCATGCAATTTCTACCCCACCATCTTCTCCCCAAGGAAAATA
GTCCCTAATGCATGTGTGCAATGCTTAGAGGGCAGTAGATGCTCAACAGATGCTGAGAGA
GTGAGGGAGTAAATGAGATATGCCATGAAAAGGAGCCCCTGTGGACTTATGCGTGCGTTT
GTTTAACTTGTGGGCAAGTACTTATAGACAGGTGCAAACAATAAATCTCCTTTTGCAACT
GAGAACTTGTTGTTCAGTATGAGTTTTGATACATATAAGAAAGGCTATTATGATACCTAA
GACAGTTAACTAAGGGAGGGAGTATTGATAACCATAAGTGTTAGTTGCAGGCTGGGCACA
GTGGCTCATGCCTGCAGTCCTCTCACTTTGAGAGGCTGAGGTGGGAGGATTGCTTGAAGC
CAGGAGTTCAAGACCAGCCTGGGCAAGAAAGCAACACCCCATCTCCACAAAACTTTAAAA
GTTAGCTGGGTGTGGGGGCATGTGCCTATAGATGTAGCTACTCTAAAGGGGAGGCTGAGG
CAGGAGGATTGCTTGAGCCCAGGAGTTGGAGACTGCAGTGAGCTTTGATGGCACCACTGT
ACTCCAGCCTAGTCAACAAAGTAAAACTTGTCTCTTAAAAAAAAAAAAAAAAACAAAAAA
AAAGGTTCTAGGACTGTAGAATCATTAGCTTAAAAGCATAGGATTTGAGGGAAAACCTCA
GTTATATTAATTTCGTATTCCAATTTCATGTTGACTTGATTTTTTATAAAGATCTTTTTT
AAAAAGGAGCCCCTGCTTCATTTGCCAAAGCTTGGAACGTTTGGGGACACCCATGACTGG
CTAAACCAAGTTCCACTGGGGCTGGGGCCATGTCTCAAGTCACTTCTGAGACTGGCAAGG
GCCTGGCATATTGGGACTGAACCCCAGGTCGATGCTAGGCATTTGCTGTGAATCAAAGAA
TCCTGAGTTTTTCAGAGTCCAGAAGAATCTGAAAGGTCAACCAAGCCAAGCCCTTTATAA
CATCCACTCATTCTGGCATTCCTCTCTGGTTCATGGAGCCCCTGCTGTGGGCCAGGCACT
GAGGAAAAGAAGAGGCAGTCTATGTCATCCCGGGGATCCTGACAGAAAGCCCTCTGTGAA
AGAAAGAAAACTCACCACCTGCTAACAGCAATGGTTTAGACAGGGAGGATTCAAGGCTTA
TTTTGTTCCTTCTTTTGTCTGTCTTCCAAAATCTCTGCAACAGAATTATGTTACTTTTTT
TTCTTTTTTTTGAGATGGAGTCTCGCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved