Homo_sapiens Locus Mono:134:AC022100.7
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:134:AC022100.7
Homo_sapiens
Mono:134:AC022100.7
5
SNORD3@L7
1001..1211
2211
CCTCCCACCCCTCCTCCCCGCTTTTGGAGCCCCCAGTGTCTATTGTTCCCATCTTTGTG
TCCGTGTGTACCCCATGTTTAGCTGCCACGTACAAGTGAGAACATGTGGCATTTGGTCTT
CTGTTTCTGTGTTAATTTACTTAGGATAATAGCCTTCAGCTGCATCCATGTTGCTGCAAA
GGACATGATTTTGTTCTTTTTCATGCCTTTGTCCATTTTAAAAATTGAGTTGTTTGTGTT
TTTCTTGTTGAGTTGTACAAGTTCTTTCTATATTCTGGATACAAGATTCTTGTCAAATAT
ATGATTTGCAAATATATTCTTCCATTCTGTGGGTTTCCTTTTGCATTCTTGATAGCGTTC
TTTCATGCACAGAAGTTTTTTATTCTGATGAAGCCCCCAACTTATTTTTCATTTGTTCCT
TTTGTTTTTGGTCTAAGAAACTGTTGCCAAACCCAAGGTTATAAAGCTGTTCTTTTCTTA
GACTTTTATGGCTTTAGCTCTTATATTTAGAATTTTATTCATTTTGTGTTAATTTTTGTA
CATGATGTGTGGTAACGTCTAACTTTGTTCTTTTGCATGTGGATAATCAGTTGGCCTGGC
ACCATTTGTTGAAGAAACCCTTCTTTTCCCCCATTGAATGGTCTTGGCACCCTTGTTGAA
AATCAATTGACCATAGTTGCATACGTTTATTTCTGGATTGTCAATTCTATTCCATTGATC
TATATGCATGACTATCCTTATGTTGGTAGTACATGATTTTGATTACTGTAGCTTTGTAGT
AAGTTTTGAAATTGGCAAATGTGAGTCTTAACACCTTGTTCTTCTTTTTGCAAGATTGTT
TTGACTATTTGGGATCCCTTGCAATTCTATGTACATTTCAGAGTCAGCTTTTCTACTTCA
GCAAAACGGAATTTGTGGGATTTGGGGACTTTGATAGGGATTGCATTGAATCTGCATATT
GCTTTGGGGAATATTGTTGTCTTAACAAAATCAAGTCTTCTAAGACTCTACTCTCAGGGC
TCATTTCTGTCATTCAATACTAGAGAAGTTTCTCTGAATGTTTAGAGCACTGGAAACCAA
ACGGAGGAGGCGGGCATTCTTTCCTGAGCATGCAGCCAGCTCATAGTGTTGTTTTGTTGC
AGCTGCCGCTTGCCATTGATGATCCTTCTTCTCTTCCTTCAGGGGAGTAAGGAGACGACG
CGGTCTTAGTGGTTCCCATAAAAATAAACAAATAAATTAATGATAGAAATTAAAATTTAA
TTTAAAAAGTGAGTCTTCTAACCCATAAGCAAAGAATGTCTGTATATTTAGGTCTTCTTT
CATCTCTTTTGGCAGTGTTTTAAAGTTTCCGTAAAGAAGTCTTACACCTTCTTGGGTAAA
TTTATTCTTACGTATTCTGCTCTTTTTGGTACTATCCCACACAATTTTTTGAACCAATTT
TTTTAACTTATCATATCATGAACATCTTTCCATGTTAATGGTATAAAGGGCAAAAATTAT
TTTATGGCACTTTATAGATATACTGCAATTTTTTATTTTTTATTTGAGACAGGGTCTTAC
TATGTTGCCCAGGCTGAACCCCAATTCCTGGGCTCGAGGGATCTTCCTGCCATATCCGGG
ACTATAGACATGTGCTACCAGTCCAGCTAGACTACAATTTGCTTCAACAATCCCTTATTA
TTGACTGTCTTGGTTATTTCAAATTTTTAATTGTCGTAAATAAGGATTCATTGAGTTTCT
TTACAATGTACATCTTTGTACACTTATCCAATTATTTCCTTTGGATAACCTCCCAGAAAT
GAATGTATTAGGTCAAAGGAGAGGAATACTTGTAAAGCTTTAATGAATGTTGCCAAATTT
TCCTCCAAAAATATCAGACCAACACCCACTCTGAATAGCAGTGGATGGGGTTCTCTTCCT
CATGCGGGATCCAGGTTGCTTTTACCCAATGTCTCTTCCAGGAGGAGAAAACAGGAGCCC
CGACATGCTCCTTCACTGGGCAGAAACTTTGAACAAGACAGTGACCGTCCCAATCAATAC
AGACATCTTCCTCTTAGGCCTAAAAGCGCCCTTTATTGGAATTTTTATTGCAAAGACAAA
TTGTCTGGATTTTTTTTGTCTTTATTTGTCTTTTTCTCCCTCTAGTCTGCAAGCTGCATG
TGGCCAAAGACTGTATCTGGCTTGTTCACTGTGTATGTCGAATGTCTTGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved