Homo_sapiens Locus Mono:42:AC068057.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:42:AC068057.5
Homo_sapiens
Mono:42:AC068057.5
2
SNORA72L6
1001..1129
2129
GACAGGAAATGGAGCCAGTGCAAACATGAGCTCAGCATTTTTTACTGACTAATTCTTCC
TCCCATAAAAAGGCTTGGTAAATATGAGTTCCAGTGTAACCTAAAGACTCGCTTAACCAA
GGGGAAAACCCACCAGCATTTCTTAATTCTAACACACCTTGTGTTATGCAACAGGTATGT
TTCTTTTTTAAAAAAAATGAACTGATTTTAAGACACACACACTAGTAATTTAAATTCACT
AGAGAGTTAGCTATTTAGAGGAACCCTGTTGTAAATCCTTTCACAAACTGAAGAACATTT
AAGTAATTACCCTCTAATTCATGTGCTCTGTAAGGTCAACTATTTAAATGTCTGGTTTTC
TTAATTTGAGGCATACCCACGTTTAAAGAGGGTCTTTAAAACTCATTATGGCTGACAAAT
ATATTTCTTTGTTTTCTTTAAAAGACAAAACTGTATTTTGGTGAAATAGGCAGAAGATAC
CTATTATTCTGGAAACTGTTTAAATACTCGTTTATTGCAAAGAGGACTTCTGTGGAGGTG
ATGGAGAACAGATATGATCAAGAATCAAACTGTCTTATATTTAAGAACATATTGTGAACA
CATACATGTGAAGCCTTTGTAATTTGTATGCAGTCTTTAAACCTCTGTGATTTATATTCA
ATCTACTCATAATTTATTTGATGGTTAACCACGTGTTTTTATTTCTCAGTGGACTTAACA
AAAGAGCTATCAACTAGTGTAGGTTAATAACAGGAATATTTTTAAATGTTTGAAATATTT
TGATATTGGAAACTATTCTTAAAAATATTTAATGAATAAGTTGTCTTTTACATGTTGTTA
AGCCAAGATAAAAAGACTCAATGAAAACTTTGCTCCTTATTGGTGACGACATGGATTTGC
ATGCTTGGTGTTTATTTGGTTGAAGCCAGTGTCCTGGGGAGGCGTATACCAGAATTCACA
CGCTCAAAAGGAACACACCAGGGGGTCGGAGGAAGCTGCTCCTGAGAATATCTTGCTGTT
CTGATTTTGTAATAGGACAGGCTATAAAGATTGGCTATATTAAGGCCACGCACATGTCCC
CAGACTTAATTCTTTCCCTAGGTCTGGTTTTATAAACTCTGGTAATAAACCAGGTCAAGA
AGAAGGTGTTGGGCTATCAGTGTGAGTAGCTTGGAAAAAATGTCAACAGACATTCTTTGT
CTGTTCAACCAAATAAACACCAAGCATGCAAATCCATGTTGTCACCAATAAGGAGCAAAG
TTTTCATTGAGTCTTTTAACCTTGGCTTAACAATATGTAAAAGACAACTTATTCATTAAA
TGTTTTTAAGAATAGTTTCCAGTATCAAAATATTTCAAACATTTAAAAATATTGCTGTTA
TTAACCTATGCTAGGTTAAGAGGCGGTGCTGCCAAGTTCTGAGAGCAAGGCTGCAAGTGC
TGGGAGAGCTCAAATCTCCCGTGTGACCTGGCCAAGGAGCAGAGTCCCAGGCACCAGACC
AGGGCCACCACGCATGCCTACAGGAACTGCATTCACCTGGAGTCCAGCACGAATGTCGCC
CTCTAGAGCACAGTGCAGGGATGACCTCTCACATAGGTAACCCATGTCCCTGGAGGCCCA
CCACAGCCCTGCTAGTCCCTCCTCACAGGTTCAGTTCCACAAAACTGTGGTCTAGATACA
AGTTGAGGGAAGAGGATTTGCTTGACCCTTCCCAATTCAACCCGGCCATACTTGTTAACA
TAAAATGCTGGCTACCCTAGACAATGGAACTTTCTAACTCTTCTATGCCACCAGCAACTT
CTCCACGCCAAATGTCAGGGCTGCCTGGTAGATGTCACCTTCCAGGGTAAACCCAAGAAG
TAGCTGGCAAGGCTAGAGATCATAGAAGGAGCAATAGCCAAAGGCACAGTGCCGTTCACC
TGACTCAGGCAAAGCCATATATTTTAAAAGTCTGAACTGTGCAGGGACCAGATTCAAACT
AGGAGCTGCCAAAAACCCGCTGATATCAGGGGACATCAGGGGCCCATCAATAATACATGA
CAGCTTCCTAAGAGAGAGGCAAGCATACTCAGTCTTGTAGATGAATATGCAGATGGTTGC
TTGGTTCTTTTTGCTCCATATAATAATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved