Homo_sapiens Locus Mono:81:AL021407.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:81:AL021407.1
Homo_sapiens
Mono:81:AL021407.1
6
SNORD3@L36
1001..1159
2159
CAGATCTTTTATGAAGCACCTTTATCCTTGGCTCCTAAGCACAATGAATCCCTGCCTCC
TGTGCCTCCACTGTTCTTCCCTTCTAATTCTATGATGCCACCATGTAATATAGTGGTTTT
CATGTTAGTCACTGAGCTTAAGGCGTCCATATGGTCTAGTGGGGTGAATAATATGTAATC
TTATCTGTCAGCCTGTCATCCATCCATCCCTCCATCAACTTGGTTAGCATTTTGATACTG
GTATGCCCAAGACTCCCTCTGATGCTAGTATTCGTGGATTCTGCATATTATCTAACTTCC
GCGCAGAGACAAAAGTACACGTTACAGGCTAAGTACATGATACAGGCATCCAGAATCATT
TATGTCTTGATGACTGCTAAATTTCCAGGGCTCAATAACTTAGTAGGTTTCAATAAATGT
GTTGAATGAACAAATTAGTTAATTCCTAGAAATTGATGGAAGATTGACTTAGGTTATAGG
TACAGTAAAAACAAATACCCCTGCCTCTAATTAAAAAAAATAAATTTACTTCTTCCAATT
GCTACAGATAATTATCACTTATATATATTATGTACAATATTCTCTATTCCAAAATGTATT
TCTGGAGAAACACAGATGAGCACACACTGGCAAGCATAGAGCAGTTAGGACCTAGCAGGA
GTAGACCAGCAGTCCTGCAGGAATACAGCCCGAGCTTCTGTAGCCCGAGGCCCTTACTGC
TATGACCCAGGCCACTCCCCTGTCTTGAGCAGGCCACACACCAGCAGCACCAGCTGGGTT
GTTAATTGTTAACTTCCAGCTTTGCCACTTCCTTCCTTCTCCAATAGCTTCCAGTACTTG
TCCTGATTTTTTCTTTTCATCTGCTTATGTTCATGACCCCATTTTCCCCTACATACCAAT
CTAACCACCCAAAGACATAAATAAGAGAATAACCTGGTGAAGTGATCTCCATTAGAACCA
ATACCACAAATATTTTCAAGTTTTCTTGAAAAAAAAAAAAAAAGACTATACTCTCAAGGA
TCATTTCTATAGTTTGTTACTAAAGAAGTTTCTCTGAATTTGTAGAGCACCGAAATTATT
AAAAAAAAAAAATTAAATTCCCGGTAGGAGGAAAGTAGATACTAACTGTGATGTTACCCC
TTGCTTATTTCTTTGAAATGAAATAAAACTGGCTTAAATGACAATACACACATCCATGTT
TGCTTTAAAGTCTTTATTATCCCGAATATAAAAGACAGAGTCCTCTAGGATATAACAGAG
TTCTTTACGTGGAAACATTATTTTTTTACAAGTGAAAAAATAAATACCTCTTGGAATAAA
GGCTTATATGCTAATATGTGCCATAAAAAAGTAGAGTTTTAATATTTGACAAAATGTCTG
TGCAAAGAAACAAATGCATAAACACATTACTGCTACATTAAGGCAATATGAAAAGTATAC
TCAGAAATCTCAGTAAAGTGACAGTGTAGGTTTCTAGCTTTACCTTAGCTAGTATTGCAC
CCGATAAGGTCATCTAGGTCTCCCGACATCCCAGAAAACCTGCTAGCTGACCAGCTTCCA
AAATGCCCAAGTGGGAGTGGAAAACATGTTTAAGAAAACAGAAGCAAAAAGAACCAAAAC
CCCTTCGAAACATACAGAGGGGACAACCCAAAGTTAATACTTAAGCACTTACTTTAAAAA
AACACAACAAAACTCCCCCCCCAAAAACAGAAAAGGACACCATATCTAAATACTTATGGT
AAGGCTATAAAAGGCTTGAACAGTTCAAGCAAAGCAACACCAGTGGGTGAAGCTGGGATC
GAGTGCTTGGGAGAAGTGATGAGTTAACTACCCTCAGTTGTACACCATGAGGCTCCATCT
CTCACTCAGCAAGCTCCGCTTTCCCTTCCCAAGGAGAGTGCTCTCTGTTTTCAGTCTGAA
ATAAAATATTCCACCAGCTCAGAAGGCCCGGGGAGTACTTGACTACTCCACAGTAATCTT
ATAACAAGATTGGTAGTATTTTATAATCGAAAGGCTTGTGGGGTAGGGATAGGGGGAGCG
TAAAGGAATAGGGAGCCACCCACATTGAGTGAGCTGCTTTTTACTAGCCACACTGGTTTA
AATCTGACAACATTGTCAACTTTTTAAAAGTCACAGAATTGATTTGTAAACCTGTTTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved