Homo_sapiens Locus Mono:76:AC021422.25
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:76:AC021422.25
Homo_sapiens
Mono:76:AC021422.25
15
SNORD18C
1001..1070
2070
GCTAAAATGGTGAAACCCTGTCTCTATTAGAAATACAAAAAATTAGCCAGATATGGTGG
TACACACCTGTAATCCCAGCTAATCAGGAGGCTGAGGCAGGAGAATCACTTGATCCTGGA
AGGCGGAGGCTGCAGTGAGCTGAGGTTGTGCCACTGCACTCCAGCCTGGGTGACAGAGCG
AGACTCCGTCTCAAAAAAAAAAAAAAGGAAACTACCTTAAAGTTTGAGGTAGTTTATGGT
GATGACTGAATTAGTTAATATTGTAAGGCACTTTATAAGAGCGCCCAGCACATCAGTCAC
CTCCTGAATATCTCTAAAATAAATTGAGTCCAAAATAAACCACAAAAAAACTGGAGGAAA
CAAAAACAACACACAGAGAACACTACACACATGACCCGCACATGCATGCAGACGTCGCTA
AAAAAGCCCAGCAGCCCTCAGACTCGAATGCACGACAGAGATATCCAGAGAACAAAGAAG
AGCTCTCGGAAATTGCCTTGATAGAAATTTAAAAATTCCACAGAAGAGTTAAAGATAAAA
TCAAGGAAATATCCTAAAAAGTAGAAAATCAAGAGATGAAAAATAGAAAAGATAATTAAT
GGAAGTCTAACATGCAAATCATAGAAGTTCCAGGAAGAGTGAAAAAGAGAAAAAGAAGGT
AAAAAGAAATAATGCCAGAAAAATGTCTACAAGAGGATGTATATTTTCAGACTGAAGGTG
CCTCTGAGCAGCAGACACCAAGAGTGGGAAGGGGGACTGTCGTTTATCAAAGTCTTGCAC
TGCTATCTGATTATTTACACTAGATATTTAATAAAAAATAAAAAATGAATTAGAAACAAA
ACAAGCAAACAAGTATTTAGCTTTAAATGAACATCAAGACCCAGACCTAGACTCAGAGTA
TATACAAGGGAGAACCGGAGGATGAAAGGTCAAGAAAGCAATTTCTAGCAAGGAGAGTTA
AAAGACCTAATAATATTTAGTCAAGGAGGGGGAGGGAAACTCTATTATGATGAGATTACG
CTCTGTGGTCCGTGTTTCTGAAACACAGGATTTTGTGGAAGTTCTCATTTGTAAATAAAA
ATTTAAAAACCTCCTAGAATTAAAGTTGCAGATCTTGGCTCAGTATGAGAGATGATTTCT
AACAAGTAGCATTTTCAAAATGGGGAATGAACGCCCTTGTGAGAGCATGAGTTCATGAGT
TGTTCAGGCAAATGCTGGCTAACCAGTAAACAAGGTTATGACATTAGAAGAAAAGAAACT
ACAAATCTGCCATTTTATAACATACAGCCACAGGTTCAAAACACAATCTTTGTGTTACGT
TGTTTTCAAAAGTAAGTAGTTGAAATACATGGTATGTCTAAAATATTGCTTGTACCGTCA
CAGTCTGTGCTGGTTTCTGGATTCAGCTCCTGCATACTCATTTTCTCAGGTTTTGACAAA
AGATCTTTTGATGTGCTAAGAACATCCTCTTTTCTGTCAGAGGTGTCAAGGTCCTTTAAC
GTACTGCAAATAAAAAAAATGTTAAGCCAATCATACTATAGGCTAGACTCAATAAATGTA
TAATTTTGAAACCCTTAATATTTTTCTACCACTGATCAGACAATATATAACAGAAAAGAG
AAGTAGTTTTTTAAATTTCCTCAATTATAAAACTTCTTTAGCTGGTCCTCAAAGTTGTCC
AGAAAGAGCCCTTTTCAACATTATCTCCGATTATGTCCTTTCAGTAACACAAATCTTCAG
TCATACTGTACCACTTACATTCTTCATATAAGCCCTGCATTGCCTATTTTGGGGATTTTG
CCACTGATCCTCTCAATTTGGAAAACCTGCCATTCCAATCTCTTCGTACCCAAATCACAC
CTGTTCTTCTAGCCCCAGCCAAAGCATTACTTCTCCAGCAAGTGATTATTAATGTCTCTT
TTTTCTGAGATTTCAAAGCACTTTTTCTGGACTTCTCTTATTATGCAAATATATGTACAT
GTGTTTTTGTGTGTCTGCATATATAATTACCTCACCACACAGATTATACAAAAACATATT
AACATATAAACCTGGTCAGTCTGATTACATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved