Homo_sapiens Locus Mono:264:AC090287.9
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:264:AC090287.9
Homo_sapiens
Mono:264:AC090287.9
17
SNORA70L4
1001..1135
2135
CTTTACTCAAACTATAAACTCTATGAGGGCAGGGTCTTCATTTTGTTCACTTTATATCC
TAGTATCTAGAGATGTGTCTGGCAAGTAAATTTGTAGAAGCTGCGTTCAAGGAACAGGAG
TGGAAATTAAATAAAAATGAACAAAAGATGTCACAAAATATCACAGGATTCTTCCTCAGT
AATCTGGACTGACCAAATCTTCATGCAATGGAGTATGCTGAAAGCTTCAGGGAGAAGAAA
GGGCATCAGCTAGAACTCCGGTAGTGAAGCTGCCCTTTAGATGTCCTGGAGTTATTTTGG
GTGTATGTACCTTTACACTCCAGTCATCCCCCCACCTCCCACATCCTCTCCAACCACACC
GAACAGGTTGTTGTTTTCTACAAATTGATATACCTTCACGCATTCTGTTCCCCTTCCCAG
AGGACCTTTCTCCTGTGCCCCCTTCTACCTTCACTTCCTTTCTGCTTTGCCACCTCAATT
GTATCCTTCAAAACTCAAATCAGCTGTCACTTCCTCATTGCGATGACCCACCTCTGTGCT
CCCATATCACCCTCTACAATCATCCAGTGCTAAAAATCACTGTTTTATTTGTCTCTGCCC
TACACTGAAGACTTCTTGAGAGCAGAGTCCATGTCTTATTCAGCCTATATTTCCAAACCA
AACACTATGCCTGATATGAGAATGAATGGTGAAATGGAAGATCTCTCCCCCACGGCTCCA
CTACACAAACACACATACATCCCACTCACAGTAGTGACTGTGTCCTCTAATTCCAGTACT
CCCTTCACTAAGCTATGACAGTGCTCCATACAGAAGTTGTTTCAATAAATACAATCATGA
AAATATAAAAAGTAATATCAGGGGAGTACTTTTACAACTAAGTAGGAAAACATGTTACAA
CGCTATACAATGCTACAAAGTAAAATAGTGTGCTAAATGTGCAAAAGCAAACAGGCAAAT
CAATGAAATAGAGTAGAAATCCCATAACAAATAAAAGTTTGTAGAAGCCAATTAAGCCAA
CTGAGTTTCTTTCCTCACAGGGACCTGGTGTGCCATGGCTGCAAACAGCAGCTTCCTTGT
CAGGGTACGCAGACTGTTTCTTGGATGGGTTGCTCTAAGGGACCTTGGAGACAGGCCTTT
CAAATGTATGTTCATGTCTCTGACCTTGCACTACCCCCAGTGTAGGCTCCAAACAGATTC
CTTGGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATAGGCCAAGTCATCATGTCCAT
GCGCACCAAGCTGCAGAACAAGCAGCTTGTGATTGAGGACCTATGCAGGGCCAAGTTCAA
GTTACTTGGCTGCCAGAAGATCCGCATCTCAAAGAAGTGGTGCTTTACCAAATTCAAGGT
GGATTAATTTTTTTTTTTGAGATGGAGCTCGCTCTGTTGCCCAGGCTGGAGTGCAGTGGC
GCAATCTCAGCTCACTGCAACCTCCACCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCC
TCCCAAATAGCTAGGACTACAGGTGTATGCCGCCACCCCCAGCTAATTTTTTTTGTATTT
TAGTAGAGACGGGTTTTCACCATATTGCCCAGTCTGGTCTCGAACTTCTGAGCTCAGGGA
ATCCGTCCGTCTTGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCACGCTGGGC
CCAAGGTGGATGAATTTGAAGATACGGTGGCTGAGAAGTGGCTCCTCCTACATGGCTGTG
GGGCCAAGTACATCCCCAGTCGTGGTCCTCTGGACAAGTGTCCGGCCCTGCTCTAGTGAG
GGCTTCCACTGTGCTGCCCCCTCCTGATGCCCACCAGTAAATCCTACTTCCTGTCCACCT
ATTTTTAAAAAAGTATATATAAGTATATTTCATGACAGTGACATTTTCTAATCAATTATG
AAATGACCAGTTATTCAGAAAATGCTAAGACAAATTGGTTAAAGATCTGGGGTAAAAAAG
AACACTCAAATTCCTATATCATATCATATGCCATTATAAATAAAGATGAATTCAGTACGC
CTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCAGATCATGAGGTCAGGAGATTGAGA
CCATCCTGGCCAACATGGTGAAACTCTGTCTGTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved