Homo_sapiens Locus Mono:201:AL732371.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:201:AL732371.4
Homo_sapiens
Mono:201:AL732371.4
X
SNORA16AL1
1001..1132
2132
TCACAGAGTGTTTTGATATGTACAAAGCATTTCACACACTCCTACTTGTTTGAGCACCT
CAAGACTTTGGAGATGTAAGCGGGTATTAATTATTATCCTTTTTCCGAGCTAAGGGAACT
TACCCATATCCCTTAGTGAACCCCTGCAGGCAGCAAATAATGACCATCTTTTTTTAATCT
CTTATTCAAAGGCAGGATTTTGTATACCGGGATTTTTTTTAACTGGGTTGCATCTATCTG
AATTTTTTTCAAAAACCTCTTATTATTATAAAAATAAACAGGCCCAGAGCAGTGGTTCAC
ACGTGTAATCCCAGAACTTTGGGAGGCTGAGGTGGGTGGATCACCTGAGGTCAGGAGTTC
AAGACCAACCTAGCCAACATGGTGAAACCCCGTCTCTACTAAAAAAATACAAAAAATTAG
CCAGGTGTGGTGGCAGGCGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATC
ACTTGAACCTGGGAGGTGGACGTTGCAGCGAGCCGAGATCGCGCCATTGCACTCCAGCCT
GGGCAACAAGAGCGAAACTCCGTCTCAGTAAAAATAAGTAAAGCAAAAAAAATCAAAATC
CAGTCCGAGCACTAAACAACCAAACAGACCACACAACCTTCCAAAATACTCCCACCAAAT
TCCAGAGCCATGCCCTAGCAGCACTTCCTGAATGAGCCCAGATGTCTGACCAGGTTCCAT
TGGTAGAACATAGGGTGGAGAATGTCAGCTTGAATTGGATTAGATTACCGGCCATGATAT
AATGTGGAGAACTCACAGGAGCACTGCCCTCCAGGTCAGCCCTGACAGAAAGAGCTGGAG
CAAAGGAACCTAAAAGCCAGGCATGGGCAGGAAAGACAAGAACAGACACCTATGAGCCAA
CGATTTGGTGGCAAAGATGATTCGTGAAGAAGGTGGGATGTGGGTCGGAAGCTCTGTCCC
TCCACTTCCCAGTGAACGAAGACACAGAAATATCCATGCTGGGCGGCCCTTATCACAGCT
GCAGCTGCTTCCACATAGCTGCTGCGGTCAAAAAGGAGCCCAGAGTCAGTTTCCTTGACC
ATCACCATTCTGTTTGCTATAAGTGATCTGTAACATTTTGCGAAAATACAGTTCCATTGA
AAAAAAAGAAAAAGAGAAGAAATCTCCAAGCTGGATGTTGGGTCTGCTGCATTCCTGAGT
CTGACATGGAAGCTGCTGCTCCCCTAGAACACGCCCTTTCCCTCCTGCTCATGAAGCTGC
TGCTTAGCTGTCCCTGTCAGCCCATGTGTGCTCTTTCCTCAATGCCATAACCATCTGCTT
TCTAGCTCCTCTTGACATCACCTCACTCCAGCGTGGCATTAGTGGCCTCTTAGCAGGCAG
GTCTCAGGTCTACTCTAACAACAGAAATCAGGAATGAACAGAAGGGGGTGATTAACTCCT
CTGCTTAAAAGCCTGCAGAGATGACCTGCTGCCTAACAGAAAAGTCCACCTCCTCCACCT
GGCCTTCAGAAGCCTCGCACCCCAGCCTCCTCTCAGCAGGCTTTCCGACTGCACATGCTC
ACTCCTCAGGGGTAAGATGTTTGTCTTCTTCCCAGAACACTCTTCCCCTGCTCAAATCCT
CCAATGTACCTGCCGTACCCACGGCCATGACAGACGGCACTGCTCGTTCCCATGCTCTGC
TGCAAAGGTGGGCCTGGCAGCCTTGTGTGGGCACCATGACCCACCTCACACCTGGCGTCA
CCTGAGTGGGAGTAAGGGTTCATGGGCACACAGTATACTGGCCTTTGAGATGCTCTGACA
AGGGCTTAGGTCAGATGCTCATTCTTGGGAATGTGGATGAGAAATATCAAGGCCAATGAG
AAGAGAAAGTAGACCCTAAACAGATGCTCAGTGGGGCTGTAGTATAGAGAAAGGGTAGGT
GGGACTTAAAGTTATGAGGGCGCCAGAACCAAGCATCAGCACAAGCTGGGAGGTAGGTAC
AGAAAGGACACAAAGCCGGGGGGGGGGGCAAGAAAGGCTGCAGAAGCCTAAAGATAAGTG
GACAGTGGAGCAAACTTAACACAACCAGGGCAAGGCCTGTTAACAGTAGAACAAGCATGA
ACAGCCAAGAACTCCCACCCCTACAGACCAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved