Homo_sapiens Locus Mono:315:AP000648.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:315:AP000648.5
Homo_sapiens
Mono:315:AP000648.5
11
SNORD56L6
1001..1071
2071
AAACTGAAGAGATGGAAGTTGCAGTGAGCCAAGATTGAACCACTGCACTCCAGCCTGGG
CAACAGAGCAAGACTCTGTCTCAAAAAAAAAAAAAAAAAAAGCGAATTTAGTTCACTTTG
GTATTGTGTCAAAATGTAGATTCTTTTAAAGTAAATCCAGAGAATTTAGATGTAGTTGAA
GCTTGTAATCTGTTCTTAATTTTTTTTAATAAAAATAAAATATTTAGATTTAGAGTAAAT
CTAAAGTGAGGCCTGAAGCTGCTCCCAGGTGATACTGATGCTGCTCATTTTTGCCCAAAT
TTTGAGTCACAAGATTCTAAATTAGTGGTTTGAAGTCCTACATGCGTAATCACTTGGGGA
GCTCAATTAACACCCAGCACAGACTAATTATTAATAAATCAGAATCTTCAGTATTAGGCT
TCAATCATTGGCTTTTTTTTTTTTTTTTTTTGAGATGGATTCTCCCACTGCTGCCCAGGC
TGAAGGGCACTGGCACGATCTTGGCTCACTGCAAGCTCTGCCTCCTGGGTTGACGCCATT
CTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCACCCGCCACCACGCCCAACTAA
TTTTTTTGTATTTTTAGTAGAGACGGGGTTTTACCGTGTTAGCCAGGATGGTCTCGATCT
CCTGACCTCATGATCCGCCTGCCTTGGCCTCCCAAAGTGCTGCGATTACAGGCGTGAGCC
ATCGCGCCCAGCCAATCATTGACATTTTTAAAGGTCCCAGGTGATTCTAATGTGAGGTCT
TTACAGACATCTTGTAAGTTAAAAACTATAAAGTGTAAAATTGTCTTTACCTCCCTTTTG
GAAACCACAAATGTATGTCAAAGTTAGAACAGAAGTAGAAAGCATACAAAAATGAACTTG
ACAATACCCATCTACAGATCCGTGATAGGCATTTGTGTACAACTTGACCTACGTGACATT
TAAGGTCAGTTTGCTCCGATTATTATTAAGAATAAAGTCAACTACAATGATGGCAATATG
TTTCATCGACAGCAGTTCACCCATTGAGTGTTGATACCGTGGGTCTGAGTGAAGCTGAGG
GTGGAGGAAACACAGGGTGAGGGAGCGGGATAGTTTGCCCCTTCAAGGATTGACAGGATA
TAACACAAAAGGCGGGAGGGGGGAAAGAATAAAGTCTACCTTCTGAGTAAAGCAAAGCAA
AGTGTTCTCAGCCAATCCAAGTGGCGCCTGTAAATACCATTATCTAGAGAAAATATGATT
AAAGAAGTGGCTTTTCTGTGTAGGAAGGTAAGAAGTTTCTGGATATTTGTACTGAGTAGG
AATCAAGATTTCTGGGTAGAGAGGCTGGAAGAAAATCAGCGCCTAGTCCAGGAAAAAAAA
AAAGAAAAAGAAAACTTCTCCGAATTTTTCTGCTTGAATTCCATGAACTCAAACTTGTAA
TTTAGTCTTTAAACATAATAGTGAGTCATAATATTGCCTACGTATACGTGGAAGAAAATG
TTGTTTTACCTATCTTCCCAATGGGAAAAAAGTGGCTCATAAAGAAACCTTGACTTCCAA
CTAAACTTTCAGGTTACTTAGCCTCACATCCATTCCACTAAAATACAAGTGTGTGCTCTA
AGTAGAAAGTAGAAGGATGGTTACCAGAGGCTGGGTTGGGAGAAGGGGAGGAAGGGAGTG
GGAGCCTGTTGATCAAAGGGTACAAAGTTTCAGATATGGGAGGAACAGGTTTTGAGATCT
ATTGCACAGCAGAGTGACTGTAGTCAATAATAATGTACTACATACTTCAAAATAATGGTA
AATTTCACGTCTCACCATAAAAAATGATGGGTAAGTGAGATGATGGATATGTTCATTAGC
TTGATTTAATCATGCCACCTTATATATATATATATATATATCTCACATTGTAGCCTATAA
ATGTATACAATTATGGTTTGTCAATCAAAAATATTTATATAAATTTTTAAAATATCTGTA
CGCTAATAGAGATATTACAATCAGTGCCCATAGAGGAAGAAGGAGGATGTTGGATGAGTA
TATTTTCTTCTGATCCAACTGACTCTGCATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved