Homo_sapiens Locus Mono:18:AL512272.15
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:18:AL512272.15
Homo_sapiens
Mono:18:AL512272.15
10
SNORD60L1
1001..1073
2073
TCAGATCTCGTGAGAACTCACTCACTATCACGAGAACAGCATGAGGGTAACCGCCCCCT
ACCACGTGATTAAATTTCCTCCCACAACACGTGGGGATTATGGGAACTACAATTTAAGAT
GAGATTTGGGTGGGGATACAGCCAAACCATATCACTTGCATCACTGCTAATTAAATATTC
AAGCAGCATTTCTCCTTTGGGCATTTTATAGTTCAAACATCCCTTCATGTAACATTATTC
TATTATTTCATCTGAATTGGATTATTATTCTTTCCTGAAGTTTCAAGATGGATGTTGTGG
TCACCGGACACCTAGCAAGTCTACCTAGATAATTCAAAAGAGGAAATTTAGGTCTAAGAA
AAATTTGAGAACATTGGAAGAAAGGGATCAAGGTTAATTTCAGGGGAGGTTTTGAATTGA
CTCCAGGAGATTTTATTTCAGCAAATGAATTTATCAGAGCAAATAATTATTGCATCGGTA
GCATGGGCTGGGTGGCACTCATTCATCAGTGGGTGAGGTATGGCCTGCTCTCTAAAGGAA
TTTATAGTTTAGTGAAAAGATGGGGCATGTATGCCCATGGTTTTAATGAGCATGACAGAA
AAGCAGGAATCTGGGAAGGCTTCCTGGCAGGTGGATTAGAGCTGGGCCTCAAATGATTTT
GACAAATAGAGATGGAAAGTGAGGAAGGGTACTTCGGGAAGAACCTGTGTGAGCAAAGGC
CTAGAGGTAGGGAAGTCCAGGGCCTGCTTGGGTAGTGGCAGATACTCCATTTATGAGGAA
ATATGCAGTCCATGTGAAGGGGAGTAGGAAATAAAGCTGCAAAAATGGCTGGGACAAGAC
TTACAAGGGGCTCAGATGCCAAGAGAAGGAGACTGAACTCTACACAGAGCAATGTGAGAA
GTGGCTGTGGGGGCTGACAGTAGCTTTTGAATTTGGGAATTGTATGTTATAATTTAGGAA
GATGGACCAGGCAGTTGTGTTAGAAAAAATAGACACTTCAGAGGTTGTGATGAATTGCTT
TAATTTCTGACACCTCATATGAAAGCTGCACTTGCAGTCTTGCAAGACAGGCTTGGGGGA
GAAAAGAAAAAAGAAGAAAAAAGAGAGATACTTGGGGTGGGAGGCAAGGCAGTTGGAAGG
TTAGTGTTTGGGAGAACTGCAATAATGGCTTGAGCATGATTCGCAGCAAAAAGAATGAAA
TAATTTCCAGGGCTGGCAAAGAATGCAAGGAGGACCGCAGGTAACTCCACGGTTGGGTGG
CTGGAAGGATGTTGGCTCACCTGATAGAAATATAGAGTTCGAGGTAGAAGGCGGTGTGAG
GGGCATAAGCATCTCAGTGGGCTGATGGTGAGCAGGGGTGTCTGCTGGCACACACAGGTT
AGGACACACGGGAGACACTCCACACAGCTGGCAGTGAGCCAGGAGAGTTCACGCGCTGGA
GTCCTCTTCAGAGAGTGCTAGCTGGGGACTAGGAGGTCTCAGAAGGTCAAAGAAAGTCGA
CATGGAGAGAGTGGGAAAGAGCTGGGCCAAGGGACAGCTCTCTACTTAGGAGGCCATGGG
GGAAGATAGAGAAGAAGTCCAGTTGAGAAAGCTGGGAGAACGCCCAGAGAGGGGAGCACA
GGGTGCTTCATGGGAAGGGGAAGCACCAGGAAAGGGGTGGCTGGTCAGCAGGGTCAAGGA
CGGTGAGGGCGAAAGACCACCTGATGAGGAGGTGAGGAGGTCAGTGGGGGCTTTGAGGAA
GCAGTTCTGGTGCAAGGCTATCCAGAGACTGAGGAGGCAGAATGTTTAGACTGTGGAACA
CGCACCTAAGGGATGGGGAAAGGAAGGGGAGACTCCTTCAGCTTGCAAAGGTGGCACTGC
AGAGGTTTGACTTTCTGTGCAGGGGGTGTCTAAGTGTGTCTGTGGCTTGAAGACAGGAAA
GTAGTGAAAGAGAAAATACGCAAAAGAGGGAGAGCCACAACCGAGCAGAATGTAAAAGCA
GGTGAGAAAAGATGCCAAGAGCCATGTCTTCCTAGATGGGGAGAGAAATGAAGACACCAC
ACACCATTTCCATAGATGACCTCTCTGTTGTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved