Homo_sapiens Locus Mono:247:AC078860.19
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:247:AC078860.19
Homo_sapiens
Mono:247:AC078860.19
12
SNORA17L2
1001..1129
2129
TTTTAAAAACAAATTAGAAAAGACAAGACAAAATAATTTTCTTAGAAATCAATTCTGAC
TTACAGAAACCTGAGGTGGTGGAGGCAAAGAAAGAGATGGTGCTGGAGAAAAATACCCCA
ATGAACATTCAGAGAAAAATGGCGGTTGCACTGGTGAAGGAGCTGTAAAAAAATTTTTTG
TTAAGAGTTTAATAACAGAAATACTTCATCAGGAATATATTAAGTTTATGTTATGTTTGA
AGAAATACATCTAGGTGGAGTGCAAATTAGATTTTATCAACCTCTGATAAAATCTTTAAA
CCCCTCATGAGTCCACCTCCAGCCATTTAAAATTGTCATATCATCATAAAGTCAGCCATT
CACTTTAAACTAATAATTAGTCCCTCAAAACTCTCACTTTGTTCCACTTTTAACCTAATG
ATGAGAACAGGGAATAAAGCAGGAAAAGACAGAAACATACTTTAAAAAAACAAACAAAAA
AAAACACAAGCATATTTTTTAAGAAATAATGAAACAAAAAATTCCCTTAAATTCTGCCAA
AGTGCCCTAGCCAAAGGAAAACAATGATGTGGTGACTTCATTATTCCCTTCTTGTGGAGC
AAAAGAAAGTTGAGGACATGGACCATATAAGCTGTGTTGAAAGTAAATAAAACTAGGAAT
GAGAAGAATTACTTAGTGTATTTAGTCAATAAGGTGCACATTTTTTCACATTTTAATTTT
GAAATAATTACAATTGATGCATCTCAGCATTTTTCTTCCTTGGTAGCAGATAAAAATAAT
TGTGTATTTTATCTTCAATGACTTGTTAGGCTCACTGAAATACAGCAGTTTCAAAGACTA
CTCTTACTACCCTACCCACTAACTATATAATCAGAGAAAATCTAACATTTCTTCTTTATC
CCAGTTGTCTCACAAGTCAATACATTATTATCCACATGCCTTATATGGGGTTGACTTGAG
TCCCAAATGAGATAATCTGAATATACACTAATCTTTGGAACATTTTACATAGCGCTGCAG
ATGTGGCTGCTGTGTCACATTTGTGTTATTAGGTGGCAGAGAGAAGAGAGGCTATGTCTA
TGCTCAGTGTTCTGCCCCATGAACATTTGAATGTTTAATAGTCAGACACTTGATGGTGCT
ATTGTTTTATGGACTTGGCATGTTTTCCCTTCCTAGTATCTGGGAGAGAGGGTGGACCTA
GTGAGTGCAGTGATCTCCGAGGAAAGCCCTCCAGGCTGCACTATCCTCATCCAGATTTAA
CCAGCCCTGACTCACTGCCAGGTGCCAGGAGAGGCTTCTGAGGACTTTCTGACCTTTGTG
TTGGGTCAGCCACTAGGGGGTCTGAAAGGACAGTGGGAAGGTAGAGGGTGCCCTCAGCAA
GAGTAGCCTTCATTCATGAATTTTAGAAACTAGTGGTAGGAAAGATGAAGTCCATTATGT
GCTGGTTCATGCTACCCACCATGTCAGGATCATCCAGGAGGACAAAGAACTAGGCAAGTG
TTTGCTGGTGTTTGATTCAGTTAATAGTATTAACAGCAGCCACTTTTACTATGCTCTTGA
TTCTGTGTCAAGCTTTCTTGTTATTTATTTTTGAGACAGAGTCTCACTCAGTGCCCAGGC
TAGAGTGCAGTTTTATTGTGCTCTTGATTCTGTGTCAAGCTTTCTTGTTATTTATGTATT
TATTTTTGAGACAGAGTGTCGCTCAGTGCCCAGGCTAGAGTGCAGTGGCACCATCTCAGC
TCACTACAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGGCTCCTGAGTAGC
TGGGACTGCAGGGGTGAGCCACCACTACTGGCTAATTTTTGTATTTTTAGTAGAGGCGAG
GTTTCACCATGTTGGCCAGGCTGGTTTTGAACTGCTGACCTCAGGTGATCCTCCCGCCTC
GGCCTCCCAAAAGTTCTGGGATTACAGGTGTGAGTCACCGTGCCCAGCCATTCTTGTTTT
TTAACACAGGAAAGAAGCTGACAGAACTTGTGACTGGCTTACAGTGTGAGCACTGGCCAG
AAAGACCAGGTGGACTGGCCCCAGCCCAGATCAAGATGCAGAGGCCAAGATGTGGGCCTT
GCCCTGTGCCAGAAGGCTGGTTGGAACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved