Homo_sapiens Locus Mono:249:AC078820.28
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:249:AC078820.28
Homo_sapiens
Mono:249:AC078820.28
12
SNORA70EL5
1001..1127
2127
TTCTTGATTATAGGGGCAACTCACCCCATGCCCAGTCACTAGCACTGGCTGTTACAGTA
TTGAGGCTTCATTGCTCATTAAGATGAGTCCCTCACCTAGAAAAGGGAGAGGTTCTCTTT
GTCTTCGGTAACTGACATATATTTCCCAAGCCCTCCTTTCTTGTCTCAGGATTTACTTCC
TTGTGGGATAATTGATAATAGGAACATCAATTTTATTTTAGGGAAACTTTACTTCCACCC
ATTGCAGTATATAAAGATCCTGTGGCTGTACTATGTTCATTGGTTTCCCATTGTCAGAGT
AGTGTGGTTTTAAACACCACTTTTGAGATGCTAAAAATTCAGTCCCAATGGGACTTGTTC
AAATTCAGTTCAGTTTCTGGTCATCAAAAAATCAATCTGTTTTAAGATCTAGTCTTACCC
ATGAAAACTTTAATAATGGTAGATATCTAAAACATGAGTTAATTACCCCCAAAATGTTTC
AGTTTTTTCATTGTTATATTGCCAAAAACCATTCTGGCTATATATATTTTTAAAAGAAGC
CATTTGCATGTCCTTTAGTGGTAGAATAGAAATTTGGTTAAAATTGGATGACATTTACTT
TAATTATCTTCAAAGTATGATGAATTTTTCATGTGTGGAATGTGTGGTCTGATAATTTTT
TAGGAAACAACACTCCACTAGAGAGCGTAGAATCTTAGAATTCATCTACTTCATTCTCCT
CCTGGTACTCTACTTTCTTCTACAACGTCCCAGCCGAGCTGAGGTCTGAGCTGTGCTGCT
CAAGGCTGTCCCATGTGAATACAGATGCGGAGACCCTGTAAGGGTAACAGAGGAAGCTGT
GAACCCAGGGGAAGAAGATAAACTTGTGGACATATGTGCAAGGAGCAATTTTAAGTATAT
TGCACTAACCAACTCATGATCTGTAACTCCTTTGTTAAGGAAAAGAATGTATATCTACGT
CAAACTTCCATTTCAGAAAGCCGAGGTCAAAATAATGAGTCCTGGGGAATTCAAACTTGT
GTTAAGAAAATGTGTCCCAGTGTGCAATGGCTGCAAACAGCAGCTTCCTTGGTAGTGTAT
GCAGCCTGTTTGTTGTACGGGTTGCTCTAAAGGGCCTTGGAGACAGTCCTTTCAGATGGA
TGTACATGTTTTTGACCTTGCACTACCCCAGTGTAGGCTCCAAACAGGCATGCGAGGTGC
CTTTGGAAAGCCCCGGGGCACTGTGGCCAGTTGGCCAAGTTATCATCTCCATCCGCACCA
AGCTGCAGAACAAGGAGCACGTGATTGAGGCCCTGGGCAGGGCCAAGTTCAAGTTTCCTG
GCTGCCAGAAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTCAATGCCAATGAAT
TTGAAGACATGGTGGCTGAGAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACCTTC
CCAGTTGTGGCCCTCTAGAGAAGTGGTGGGCCCTGCACTCATGAGGGCTTTCACTGTGCT
TCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCACCTAAAAAAAAAAAAAAA
GAAAAAGAATGCTTTAACTTCAATTACCCCTCTCTCTTATGTACGTTTAGTCTGTTATTT
TAGTTTTATCCTGATTCCCTCGCATAAACATTATTATTATATTAAAAAAAAGAAAAGAAA
AGAAAATGTGTAGAGCCGGGCACGGTGGCTCATGCCTGTAATCCTAGCACTTTGGGAGGC
TGAGGTAGGCGGATCACAAGGTCAAGAGATCCAGACCATCCTGGCCAATATGGTGAAACC
CCGTCTCTACTAAAAATACAAAAATTAGCCGGACGTGGTGGTGCATGCCTGTAATCCCAG
CTACTCAGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGGAGACGGAGATGCAGTGAGC
CAAGATCATGCCACTACACTCCAGCCTGGGCAACAGAGTGAGACTCCACCTCAAAAACAA
CAACAACAATGACAACAACCCCAAAAACAAACATGAATAAATATCATTCTCCAATAAAAT
CATTCATGCCAGTTAGGGAACCAGTTAGGAGGTTGTTACTGGAAACCAGGTGAAAGAGAT
TTTATTGGAGAATGATATTTATTCATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved