Homo_sapiens Locus Mono:15:AL365398.22
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:15:AL365398.22
Homo_sapiens
Mono:15:AL365398.22
10
SNORA25L14
1001..1124
2124
CCTGTAACTTTGAAGAGCACAGGTTAAATAAGTAGGATCCTCTCTATATTATGAGCTGA
ATAATTACAGAGAATAAAGTGTATCCCCTACCACCATTCCGCTATTGTTATTATGCAGTT
GATCTTATTGCAGACTTAAAGGCTGTACATTAAAACACCTCTATGTTTCTTAAGACATGA
AATACGGGATGATTAAAAAAATACCTCTGTGTTCTAAAACAGATAGTGATGGCTACACAG
TTATGTAAATATACGAAAAAACATGTAATTGTACACTTTAACTGGGTGAATTGTATGCTA
TGTGAATAGCATAAAACAGCTCAATAAAGCTGTTACAAACAACAACAAAAACACCTCTTC
CTTAAAGACCATGAGATTATGGATGAGTGAAATGACAGCAGAGATAAAAGTACCAAATCT
ACAGGATAACAAAGATAAATTAAATAATATAAATGTTGCCTACTGACATATTTTCTATTC
ACAAGCAAGCCAAAAAGTCTCTAAGATGGTGAGAAGAAATCAAATCTATAAAGCTTGTAT
TTCTCCCATGAAACACTCCATATAAAAGCTTCGCCAAAGATCAACAACAACAATAATAAA
CATATAAACTCTCAAAAGAGATATCTTTTTTGGAAAAAGTTGGTTGGATATAAAAGAGAT
AAAGGAGATATACCAGTTAATTTCTTCTTCATGTACCTTCCACACTGTACACAAGAAAGT
TGCAACCTGAGGGGACACACCTCATATGGCCCTACTGCTTTCATTGTTCCAACACTTAAT
GAATTGTCTCACTTGATGGTCAGGCATTGCTGCTCTGCAGGTGGCCCACTCCCACTCTCC
TTAAGGGATAAGGGCTGCAAACAGGAAGTAAGTGACCCTTAAATGCCATCTCTAGTTTTA
AAAATTCACTGCATCTATATTTATAATGATGCAGACAGCAAAGGAGATGCTTTGAGTAAA
AAGGTAATAAAGGTTGATGCTACTTAAAATAGTCAAGGTATTGGTTTAAAGCCAACTCTG
GGCTCCCATCAGAAGGAAGGAGATGAATGCTATGACCAAAGACTGAAGTTCTCTATAGAG
TCCACAGCACTCAATAGTACTGTATTTTCCTGAGGAGATATAAGACTTAGCCACTACATA
ATCATCACATAATAATCCATGATTTATTATTATTATTTTTTTGAGACAAGGTCTTGTTCT
GTTGCCCAGGCTGGAGTACAGTGGCATGATCAAAGCTCATTGTAGCTTTGACCTCTTGGG
CTCAAGCAATCCTCCCTCCTCAGCCTCTCCCTATAGCTGGAATCACACAGGCATGTGCCA
CCATACTTGGCTAATTTAAAAAAACTCTGTGTGTGTAGAGATGGGGTCTCCGTATGTTGC
CCAGGTTGGTCTCGAACTTCTGGGCTCAAGTGCTCCTCCCACTTTGGCCTCCCAAAATGC
TTGGATTATACACATGAGCCACTGTGCCTGGCCTACTCATGTTTGTTGATATGGGAAAGT
AAATAAAGGTTTCAAAGTAGAAGAAGGAAGAAGAAGGAGGAAGGAAGAAAAAGAAGGAGA
AAGAGGAGGAGGAGGGGAGAAAGAGGAGGAGGAGGAAAGAAAGAGAGAGAAGAAAGGAGG
AGGAGGAAAGGGGGAAGGGAAAGGAAGGAAGAGGAAGGAAGGAAGAAGGGAGGGAGGAAG
GAAATGACTGTGGCACCTTGGAATCTGTAATAGCAAGGAAAAGGGACTGTTTACACAGGT
GGACATGTGCTCCTGACTTTTAGCACTGCAAGTTTCAGAACCTTTCTATGAGATATGAGA
CTACTACTAAAAACTTGGAGAGGTTATTCAGGAAACAAGGTTTGCCTAGTGATAGAAATT
CTCTGTAGACAATCATGGATGATCATTTTTTCTGAAAAAGAAAAAGGGCATTACCTAAGG
AAATACAAAAGTGCTTATATGAAATGGGAGCTCTCTGGAAAGCTTAAATGTAAGCTTTAG
GAGAAAGATGAATAAAAATAAAACCATGAATGAACCTAAAAATGTACCTATGAAAGGTGT
AGTTAACAGAAGCTCAAAATGCCAGAGGCAATAAAATAAAGTACTACTGGCTATATTCTA
AGCAAGAAGAAAACGAAGGGGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved