Homo_sapiens Locus Mono:39:AC068288.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:39:AC068288.6
Homo_sapiens
Mono:39:AC068288.6
2
SNORD66L1
1001..1081
2081
TTCTTTAATGTTGTTTGTTTTCTCCTCTCTCATCTCCTTTCGTTACTCTTATTGGATAT
AGATTAGACCATTTGATGTCCCACAGCTCTTTGATGTTCTGTTAAATTGTCTTTCAGTCT
TTTCACCCTACGTGTTTTATTTTAGATTATTTTTTGTTTCTCTGGCTTCAAGTTTCCTAA
TTTTTTTCTTCTATAATGTCTAATCTGCTACTAATCCCTTCCTTGGTATTTTTCATTACA
GACATTGGTTTTTGTCATCTCTAGAAGTACGGTTGGGTCATTTTCCTTGTCTCTCCTTCA
TATGCTCATGCTTTCCTCTATTTCTTGATCATATAAGATATTTATAATAATTGTTTTTAT
ACCCTTGTCTACTAATTCTACCCTCTTTGACATTTCTTGGTCTGTTTCAATTGACTGATC
TTTTTTCCTCCACATTTTGCATAGTGTGTCTCATAATTTTTGATCAAATGCCAGATATTG
TGAATTTCACTCTGCTGGGTGCTGGATATTCTTATATTCCTTCAAATATTACTGAGCTTT
GTTATGAGATGCAGCTAAGTTATGTAAAAACAGTTGGATCCTTTTGAGACTTCTTTTTGA
CTTTGTTAACTGGGACAAGCAGCTATTACAATAGGGCTAACTTTACCATACTATTGAGGC
AATTAGTCTAGGGCTTGTTTTTCCCTTCAGAGGACTCTACCCAATGCCCCCTGAGTTATG
ATGTTTTTCACTCTGCCTGGTATAACCATGGACTATTCCTAGCCTTCTGTGAGCTCTGCT
GACTACATTCCATTGAGACAGTTATTTCTCTAGCTTTGAGTAGTTACTTGCATGCTGTGA
TCAGTATTTAGCTGATGACAAGGTGAATCTTTTACAGAATCTAGAACTTTCTCTTTATGC
AACTCTTTCCCCTGTGCCACTGTGTGTGGGAACTCTAGGTGCCTTAGACTTCCCAATCTC
CCAACTCTATTCAATTCAGAGAGACCTCCAGGTCTTGCCTGAGTTCCTGCATACTGCACT
GTGGCCTGAAAACTCTCTCAAGAAAGTAAGTTGCTCCATGATGGAACTGAGGATCTGAGG
AAGGGAGGGAAAAAAAATAAAAAGAAAGTAAGCTGGGGTAATCATAGGGCTCACTTTATT
TGCTTTGCCTTTCTTAGGGATCACTGTCCTGCCCCACTTGATGTCATGTCTGAACCCCAT
TGTTTCATATATTTTGTCTAGTTTTTCTGTTTGTTTGTTGTTTCATACAAGAAGGTAAAT
CTGGTTCCTGATACTATCTTTCCAGAAACAGTATCAGAAACTAATAGAAGTCCACCAAAA
GTGCAATTCATCTCAGTGGAGGAAAAGATAAATTATTCAATAAATGGTGTCAAGATACAT
ATTAATAGGTTCTAATTTGCAATTACAGGATAAAATCTGAGACAGTTTTAACAGAAAAGA
AGTATATTAAACATTATTAATAGATTACAAATTTTCCAGATGGGCCAGAGAGTTAGGCTT
TGAGGTGAAGCACTTGGAAACTGAATTAGCCTGTCAAACTATTCAAAGGAATGACTGCAG
CATTCTGGTGCTGGCAACATACTTCACACCATAGTTGTGCTGTTGCTGTTGCTGTTGCTG
TTGCTAACTTCTCCATGTTTTTCTGCTGTGCTTCATCACCCTCTTCGGGAACTATGTTTT
GTAGTACCTGCCTTCTCATGATGTTTTTTCCAAATCAAGATTTCGTGAATGCATACCTAG
TTGATGAAACCTAGGTCATGCACCTTCTTCAGAGCCACAGGAGAAGCTGGGGAATTGACT
TTGTATCTGCCTTACTTTGATGAGACAGAATACAATTTTAGAACATCCACAAGTATAGAA
ATATGATTCAAATGACACTGGGTGGCTACAAATAGGACAAATAGTCCCACAACACAAACT
GAGTAGTCATGTGAAAACAGGTGAAGTTGAATCCCTACCTCACACCTTATACCAGAAGGT
CAGAGAAACCAGGAAAAAAAGAAACCATAAAGGTACTCAAAGAAAATTAAGAATTTTTAA
ATAACTCATTTTATTTTTCATATTGCTGCCTTCTAATCAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved