Homo_sapiens Locus MGC16037
snOPY snoRNA Orthological Gene Database
Homo_sapiens MGC16037
Homo_sapiens
MGC16037
9
SNORA17, SNORA43
2306..2437, 2941..3076
5522
GGGGTGTTTTCTGGCTTTGCAAAGGCAATGAAAATTTGAGTTGAATTTATCACCAGCTC
CTGCTCCCTCTAAGCCAGTACCCGAGCTGGAGCCAGCTCCTATGCCAGCTCCCGCACCCC
GGCCTTCCTGGCCTTTGCCTGTGGCTGCAGAGAGCAGGCTGAGCCAGAAGCCTCATCTCC
TGGTGTCCCCTCCAGGCCTAAGGCTAGAGCGGTCTGCGCTGTGCAATGCGGAGGCTGCCC
AGCCCCAGGACAGCAGCGCGGCCTTCCTCCCGGCCCCTGCGGCTCAGGCCTGTCATCCCC
TGCTCTGGAGCTCGCGTCCTGGTCCGAGTCCCGGCGGCTCCACCGTTCGCAGCCCGGCGA
CCGCGGCGAGTCGCTTGGCCGCGAGGCCTCGGTGTCCCGCCCTGCGCGGTGACCGAGGTC
CCAGGACACAGCGCAGACAGGGCGCTAGTCAGGCCTGGCCGCGGTAATCCCGCCTGCCGG
GACCCTCGCCCGCCTCAGCACTCATTAGGCGCCTGGTGTGTACCCGCGCCCATGGCCGAC
ACCGGCAGAGCCCCTGGTGGGGAAGGGACGGAGCGCGTCGCGGGAGCCCCATGCTGCCCG
GGGTGGGCGCTGCTCGACAGTCACGGGAGCCGCCCCAATGGCTGGGACCACCGGGACCCA
CGGGCTCGTGGAGCGTCCTCCTGACCCGGCCTGGGAATCCTCCGCGAAAACGGGGAGCCG
CGCGTGTCCGTGGCGTGCCCGGCACCCGGCGGGTCGGAAACGGCGCGGCCCCGGCTGCTG
GCCCCGTGGGGCGGTCGCGGTGCAGGACACGGGTCACGGCGCTGCCGCTGCTCTGCGTGG
CGAACCCACACGCCCGCCCGCCAGCCACTGAGCAGCGCCCACGTGCGGGCGCGGGGAGCT
GAACGGCCGGGGACCGCTGGGGGGCGCTGCTTGGGCGGGGCGGATTGACTCTTGCGGGCC
GCCGTACGCGCTATAAAAGGCGCGGCGCTTCTCTTCTCGTCCTCTGCGTGCGCCGGAGGC
TGCCGTGGCGGGTGGGCCGCCTGACTTCTCCTCCCGGCCAGTTCTCGAGCGCCTCACCGG
GCCTCGCCCTGCAGCCTCGCTCTCGCTGGCGCTGCGCGGCCTAGGGGACTGGGCTGCTGG
CCTCCGGGTGCGGGGTGGGGGCAGGCTCCGACCTGGGGCGTCCTGGCAGCGCGAGCCGCG
GGATGGGGGCCCGGGCCGCGGAGGAGGCGCCGCTGCTGTGTCCCTTGGTGGAGAGGGCGC
TGCCGGCCCTGCGCGGTTTCCAGCCAGGAAGCTTCGGGAAGCCTGGTGAGAGCTGAGTGC
GCGAATTCGGATCTTAGAGAAAGGCACCCCGTTCACCCACGACCCTTCCGCTCCTGCCGC
TGCTTCCCTGAGTCGCTCAGGCTGTGGGAAGATGTTTGTCGGCATCTTTGAAAAATTGAT
TTCTTATGCTGCGTCAGGTGGTTTCCTTGTCACTGTGGCTGCTCAGCGGGAGGCTGTTCT
GGCGGGAGGAGGACTGCTCGGTTGTCTGGTGGGCATTCCGCCTCGTGGTCCTGGTCCCTT
GATACCTGCAGGGGATCAGCAGCCCGCGTTTCGTGGCCACTGTGTTGTAACTCCAACTTC
CCCTCCCGCAAATTAAGCGTAGAGTAAGGGGAGAGAGTAACATGGGTCGGATTTTTCTAG
AACGGCCCTTGTGACAGTGAGCTTTTTGGTGGCAGGGACCTTCTTTGGTCCGCCTTCCTG
GAGACCAGATGCAGCAAAACGCAGTCTTTTTCTTTTCGAGACAGAGTCTCAGTTGCCCAG
GCTGGAGTGCAGTGGCGCGATCTCAGCTCACTACCACCTCTGCCTCCTGGGTTCAAGCGA
CTTTCCTGCTTCAGCCTCCAGAGTAGCTGGGATTACAGGCGCCAGCCACTAGGCCAGCTA
ACTTTTTTTTTTTTTTTTTTTAGAGAGACGGGTTTCACCGTGTTGGCCAGGCTGGTTTTG
AACTCCTGACCTCAAGTGATCTGCCCGCCTCGGCCTCCCAAAAAACGCAGTGTTTATGTG
ATGCTCCTCTGTGGTGTTTGCAAGATTTATACAAAATTGCGGTTTCTTTTTTTCTCTAGG
ACGTCTGCTCACTGGAGATGACACGTGCGTGGGGTGTTGGGTAAGTTGGTGCATTGGAGC
TGGAACAGGGTCAATCCTCCAATGTAACTAAGCCCTCCTGTGCAACATCTTAAGTGACTG
GAGGGACCAGTCGGTCTTGTGTTCACATTGAGGCTAGAAGCTGTCTCCAGGGGAGTAAAA
ACGGATTATTTAGTCTTCAACAGGACACTGCCCCTAGAGGCGTTGCAGCTGTGGCTGCCG
TGTCACATCTGTGTCATTAGGTGGCAGAGATTAGAGAGGCTATGTCTACGCTCAGCGTTC
TGCCCCGTGAACGTTTGAATGTTTGATAGTCTCACACTCCTGTTTTGTGGACAGGCATCT
GTTTTCCTTTGCTGGTATCTGGGAGAGAGGGTGGGCCCTGTGAGTGGGCTTTCTAACTCT
CGCGCTGGGCTAGGCTGGCCTCTAGGGGTCTGAAGGGATAGTGGGAAGGTGGAGGGTGCC
TTCACCAGGAGCAGCCTTCATGAGTGAGTTTTAAGAACCTGTGAGGATCGGTCAGGTCTG
GTGTGCGCTGGATCATGCCGTACACCGTGTCAGGATCACGCAGGACAGGACTGGGGAAGG
GTTTGCTGGCGTCTCGGTTAATAGCAGTAACGGCAGCCGCTTGTGTTCTTGATTCTTTGC
CAAGCATTCTTGTTATTTAACACGGGAAGGAGGTGACTTCGCCTGTGATGGACTTCCAGT
GTGAGCACTGGCCAGAGTGACCAGGCTGACCAGCACCAGCCCTGATCCAGGTAAGAGGTG
AGGCGGAGGCTTGCCCTCCTTCCCTGCCTGCCGGGTGCGTGTGAGCGGCTGCCCTGCGGA
TGCTGTCCTGGACCTGTTGGCACCACAGACAGTTGCTCTGCTGTGCCTGTGGCCTCGGGG
CAAAGAGAAAGTGGCGATTTCTACACTCAGTGCTCGGGAACCAGTGGGCACTGAGAATGG
TTTATGGCCTGACATTACTTGCAACCAAAGCCAGGCAGCATTTGGATTTTCGCTTTTGGA
AACCACCTTACCTGGTTTGCTCCATGAGGGAGGGGCAGCAACATCGCTGGGAACCCTGAG
GTGTAGATATGTATAAATGAGCTGTGTGTGTATCTGAAGCTCGGGCACTTGTGGGGTTAC
CAGGAGTGTGCGTCTCACTCCCAGGCCTCGTTCTGGAAACGATTCTGTAGGTCTGTCTGG
GAGGCCTTAGGCAAGTTTGATCAAGAACAGTCGAGCTGGATAAACAGGCTGTTCCTTGTC
CAGCACTAGTCATCCCAGGGGGGCGGGGGCGGGGCTGCAACTCCTGTGCACAAAGGAAGG
GCCCTGGGTAGGGGTCAGGAGCTGCCTTGCCCAGAGATGTGTCTGGGTCACTTTGGAAAC
AGGAATCCTCTCCCCAAAATGGGTAGCAATGGGGGTACAGAGGCCAAAGACGCAGCTGCA
TGTCCTGCAGTGCCTGGGACGCCCCGTAGTGAAGAGTGATGTGGCCCAAATGTCAGCAGT
GCCAGTGTCAGACTCCTGCTAAGAGACAGTATCAAGAAAGATAACTTCAAAATACACTTT
CTGGAGGCCTGGCGCGGTGGCTCAGGCCTGTAATCCCAGCACTCTGGGAGGCCAATGCAT
GTGGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACTGCCTGAAACCCCATCT
CTACTAAAAATACAAAAATTAGCCAGGTGTGGTGGCGCAAGCCTGTAATCCCAGCTATTT
GGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGCAGAGGTTGCAGTGAGCCGAGA
TCGCACCACTGCACTCCAGCCTGGACAACAGAGTGGGACTCTGTCTCAAAAAAAAAAAAA
AAAAAAAAAGTACAGTTTCGGGATTTCATAAATTGGGTTCCCTGAGGGTCATTTGGTGAA
TCCGGGTTAAAGAACCCTGGTCTGCATCACTGTCCTTGTTTGTTTTTCAGATGCAGAGGC
CAGGATGTGGGCCCAGCCCTGTGCCAGGAGGCTGGCTGGAATAAAGGTACAGATAGAGGC
CTCACCCCCTCTGGGACCACTGGCACTCAGGGTGTTTGCAGCCTCAGAGCCCACCTGCCC
CCAGGGCCACAGCTGCATCTCCTGCCCTGCTGTCATTACAGGGATGGGCAGGCTGGCATG
GGGGCAGCCGCTGCCCCTGCCTGGGTGTTGCTGTGTATTCCTGCCGGCCAGGGGCCACTG
CCAGGACCACGCCTCCCTTTTCATATCCCGATTCTTAAGTTCTGCTATTGTGGTATTCTG
GTGGAGAAAAAAGAACCGCGTGGCTGTTTTTGAACTGCCTGGAACCTAAGACCCTGAATT
CTTTTCCCCCCCAAGGGGAAAATCTATATGGAAAACATTTATTTTAAAATACAGGATGAA
GTGAATTAAAAGATTTAAATGCACATTTCTTTAAGGATAATATTTCTGTGTTGGCAAAAT
TTGAGAGTAAATTGGTCTTGAATGGAATGGATTGTCTTGACTCACACATTGCGGAGCAGA
GCCCGCCCTGAAGAAAGGTGTTGCTGTGGTGGGATCTTCCCACGAGGGTCCTTGCCTGTT
CTCCTAGGGGATGGTTGCTGGGTGCCCTGGGCTACTGGGGAGAGCGTACGGGGCTGGAGA
AGATGGCCATTCCTGGGCTGTTTCCTAGGGAATGAGTTGTACATCTCATGGCTGGATTTT
GTAAAATCAGTTTTTAAAATACCGCATATATCTGTTTTCTTACTGGAACACCTTTTTCTT
GGTCTGTTGTGCACAGCCCAGGTTTGGGGGGTACTGGTCATTGACTGTTTCAGAAGCCGC
TGTGTTTGGGGAACTGCCCTGGCGGCTTCAGAGGTGTGTGTGGGTTGAAGGGCAGGCAGC
TCTGCAATAGACCTCACCTTGGACTAACACCTGAGGGCTGCCTCGCCAGGAAGGATTCAG
GGGCTCAACCCCAGCCTGAGTGCCTGGGCTGGGTGGATCCACAGCGGGGCGAAGGGTCCC
ACACACAGCATCGATGGGGGCTCAGGGTGCTCAGCCCTGGGCATTACATAAAAGCTGTTT
ATTGACATTACGTTCTTCAGAGTAACAAACCCCCTTGGAGGACTCTCCTGCCGGGATGTC
CATGTCCGCCTTTGCTCCGAGCTGGGGTCTCATGTCTGTGGTGCTGGAATCCAGAGCCCT
GACGGTAGGGGAGTGATTTTGCAACACAGTTGCATTTCACATCTTCTGACAGGATTCCTT
GAGGGAGGGTTGGACCCTGGCACCTGGCCAGCTCCAGGAAGGGTGGCCAGGCCCCTCACT
GCCCCATCAAGAGTACTTGGTGTTGGAGATCTTCTTCCAGAGCAGAGTCTTGAGGTGGCT
GAGCACCAGCGAGTGATGGGCCTCCACCTGGCTGGCCAGCCCGCTCAGCGTGGTACAGGT
GCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1304, 2099..2139, 2764..2869, 4070..4522
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved