Homo_sapiens Locus Mono:19:AL117334.29
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:19:AL117334.29
Homo_sapiens
Mono:19:AL117334.29
20
SNORD3@L13
1001..1211
2211
TCTCCAGGTCCAGGATCTGCCTCTAATACTCATTCCCTAACACTTTTTTTTTTTTTTTT
TTTTGAGATGGAGTCTGGCTCTGTGGCCCAGGCTGAAGTACAGTGATCTTGGCTCACTGC
AACCTCTGCCTCCCAGGTTCAAGTGATTCTCCCGCCTCAGCCTCCCGAATAGCTGGGATT
ACAGGTGTGTGCCACCACGCCCGGCTAATTTTTGTATTTTAGCAGAGATGGAGTTTTGCC
ATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCCGTCCGCCTCATGCCTTA
CAGGTGTGAGCCACCGCGCCCAGCTTCCTAACACTCTTATATTTAATACTTTCTCTACAG
TCAATATAATCCCAGTCCTACTACATCATTATTAACTAAGAGCCTCTACAAACCAACTAC
ACTAATTCTTCCACCTATGAAGCCAGGCATCATCCCCATCCCTTACTGAATCTCCTCCAG
TACACTGCCTTACTCTCACCTCAAAACTGTATTTACAGCCAAACTACACTATTTCTCTTC
ACTAATTCCTGAATTCTTTTGCCCCACTGGATTCTTTTTTTTTTTTTTTGAAATGGACTC
TCACTCTGTCGCCCAGGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGTAACCTCCGCC
TCCTGGGTCCAAGCGACTCTCATGCCTCAGTCCCCCAAGTAGCTGGGATTACAGATGTAC
ACCACCATGCCTGGCTAATTTTTGTACTTTTTAGTAAGAAGGTTTCACCATGTTGGCCAG
GCTGGTCTTGAACTCGACCTCAAGTGATCCACCTGCCTCAGCCTCTCAAAGTGCTGGGAT
TACAGGCATGCGCCACCACACCAGGCTGCCCTGCTGGATTCTTTTTGACGTTCCTATGCC
CCAACTCATTCATTCCATGACTTGGCGCTCTTCATCACTATCTTCCATGAAGAGTTTCAT
AGTCTTCCATGTGATATCAAAACTAGACAAAGATAGTACCAAAGACTATACTTTCAGGGA
TCATTTCTGTAGTTCATTATTAGAGAGGTCTCTCTGAATGAGTAGAGCACTAGAAACCAC
AGAAGGAGGCACAGTGGTCTCTCCTGAGCATAAAGCTGGTTTTTGATGTTGCTTTGCTGC
AACTGCCATTCGTCACTGATGACTGTTTTCTTCCTCTGGGAGAGTAAGAGGGAGAGGACA
CTATCTGAGTGTTTCCTCTTTAATCATCAGTCAAAAACAAAAAGTATCAAAAAGAGAAAG
AAACCTACAAACCAAAATCCATCATGAATATAAATGTAAACATCCTGCCTTTTTTTTTTT
TTTTTAAAGAGATGGGGTCTCATTAATGTTGCCTAGGCTAGACTCGAACTCCTGGGCTCA
AGCAATCCTCCCTCCTCAGCCCTCCTGAGTAGCTGGGATTACAGGCATGCACTACCACAC
CTGGGAAAATTTTTTTTAATTAAATGTAAACACCCTTAACAAAATACAGTAAGTAAAATT
CAGCAACATGTAAAACAACTATACACTAGGACCAAGTGGAATTTATCACAGAGATACTCG
AGGCTGGTTCATTATTCATGAATCCATCAATGTAATCCCTCATATTAACAGGCTAAAGAA
GAAAAATCACACAACCAAAAAACTGATGCAGAAAAATCACTTAATAAAAGTCAACACCCA
TTCATAATAAAAACACTCAGAATTGATGGATATCCCAACTACACTAATTTGATCTTTATA
AATTATATGAATGTACCCTGAAAATGTGTGTCTCTATTATGCATCAATTAAAAAAACAGA
AAAAAAGCCACTCAGAAAACTAGAAATAGTTTCCTCAACTTGATAAAGATCATTTAAAAA
ACCCACCAAGCAAAGTTTGTAATTACACATAATGGTCAAAGTCTGAATGTTTTTCCTCTA
AGGTCAGGAAGAAGATGAGCATGTCTACTCTCATTATTCCTATTTAACATAATACCGGAA
GTTCTAGCCAACAGAATAAGGCAATAAAAGGAAGTAAAAGACACATAGACTGAAAAGACA
GAAAGAAAACTGTTCCTATTTGCAGATATGTCCTATTTGTAGATGACATGATGGTCTCTG
TAGGAAATCTTAAGGATTCTACCAAAATTCCTAGAACTAATAAGTGAGTTCAACAAGGCT
TCAAGATACAAGATCAACATATAAAAATCAATTGTAATTTTTTTTTTAGACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved