Homo_sapiens Locus Mono:26:AC007240.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:26:AC007240.2
Homo_sapiens
Mono:26:AC007240.2
2
SNORA51L10
1001..1134
2134
GGATGCTCTCAAAAAAAAAAAAAAAAAAAAAAAAGAAAACTCAATGCCTGTAACCCCAC
CACTTTGGGAGGCCGAGGCAGGTGGATCACTTGAGCCCAGGAGTTTGAGACCAGCCTGGG
CAACATGGTGAAACCCCATCTCTACTAAAATTACAGAAATTAGCCAAGCCTGGTGGCGCA
TGCCTGTAGTCCCAGCTACTTGGGAGGCTGGGGTGGGAGAATGGCTTGAATCCGGGAGGT
GGAGGTTGCAGTGAGTCCAGATCATGCCACTGTACTCCAGCCTGGGTGACAGAGCCAGAC
CTTGTCTCAAAAAAACCCAAAAAACAGCTGCTTTCCTCCTCCCCCACTCGCTGTTCCCTC
CTCCTCATTAGCAAACTTAAAGCATTCCCTTTAGCAACCCTGATTAGGCCCCAATCCAGG
GTCCCAATTTTCTAATTTGTAAAATGTGCATATGAATCATGTCTCGCTTGGATTAAAAGA
GGCAATGTGTGCAAAGGGCCTCTGGTGAGGTAGCTCCTCAAGAAGTGATGGGCATGTTAC
TTCGTTGTCATGTCCTCACCCTCATCATCATCCTCCCACTGACTGACCACTCTGCCCACA
CAAATAAAGAAAGCCATCGCAGCCATCAGTCGGAGCCCACCGGTGCTGGCCCAGCTCAGC
ATACGCTATCGGCATCACCTGAGCAGACACCCAACCTCTCTGAGTTCCTTTCCCCCTGAG
GGCTCTCTCTCAGATGACCCAAGGGAGGGAGGCCAAGGCACCAAGGAATGGGAAATGGCT
TTGTAAAATGTGAAATGTGCTCCTGGACTACACATCTTCAAGTAGTGTCAGAGGCATTTG
AACCAGAGTGACTCCATCTTGAGGAGGAGCTGGGTAAAATAAGGCTGAGACCTGCTGGAC
TGCATTCTCTGGCGGTTAGGCATTCTAAGTCACAGGATGAGATAGGAGGTCGACACAAGG
TACAGGTCACAAAGACCTTGCTGATAAAACACGTTGCGGTAGGCCTCCTGGTACTTACCC
ACAGGCTGCGTTCTTACACTGGCTGTACAGAAAGAGGAGCTAGAGTAAACCTACCTAATA
TACACCTCAGCCCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGGGACATAGAAAAG
AAAAAATAAATGAAAAACAAAAAATAAAACAGGTTGCAGTGAAGAACCTGGGCAAAACCC
ACCAAAACCAAGATGGCGACAAGAGTGACCTCTGGTCATCCTCACTGCTCATTATATGCT
AATTGTAATGTGTTAGCCGGCTAAAATACACTCCCACTAGTGCCACGACAGTTTACAAAT
GCCATGGCAACATCAGGAAGTTACCATATATGGTCTATAAGGGAGAAGAGCTCTGAGTTC
TGGGAGTTGCCCATGTCTTTCCTGGGAAGTTCATGAATAATCCACCCCTTGTTTAGCATA
TAATCAAGAAATAACTATAAGTATAATCAGTTGAGCAGCCCATGCCCCTGCGCTCTGCCT
ATGGAGTAGCCATTCTTTATTCCTTTACTTTCCTGATAAACTTGCTTTCACTTTACTCTG
TGGACTGGCTCCCAATTCCTTCTTGTGCGAGGTCCAAGAACCCGCTCTTAGGGTCTGGAT
TGGGACCCCTTTGTGGTGACAGTAGTGGCTCCACAGAGTTGGGTTGGACTTCTGTGCCCT
TGCTGGTTTACACAGTGGGGTGGAGGCAAGCCTGAGGCCATGACACATGGTTGTCCAGTA
CAGGTTGGGACGCCACATCAGCGGCAGCTCAGGCCCCAACATGGAAGTCAGAAGCCCCAG
CCGGGGGCTCCGCACAACACACAGACATCTTTTCCATGTCAGTGGAGAGAGGGGAGTAGC
CCAGAGTCTGGCTGGCTGCAGAACGCTCATGCTAAAACACAAAACCCAAAGCCAAACACA
AGCAGCAGCTCTGACCTCTGCTTCAAACCAGTTTGAACCGGAAAAGGCTGCCTGCCTTTC
CAGCTCTGCTTCTGATGATGGTTCCTGTTCTGGGAGCTAGAGCTCCTGGTGCATATGCCA
AGGACGTGCCCTGCAAGGAACAGTAGGTGAATTTCTCCCTGAAACATATAGCTCCATGAC
TAATGGGGGATGGACATAATGTTAATCATATATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved