Homo_sapiens Locus Mono:235:AC103590.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:235:AC103590.2
Homo_sapiens
Mono:235:AC103590.2
1
SNORD3@L20
1001..1213
2213
AACCACACAGACATCTGAAGGAAGATCTTTCTGGGCAGAAGGAACAATGCGCATGGGAA
TTCAAGGGACACCAAAGAGGTCAGCAGGGCTGGAGAGGAGTAATGGCGAGGATGAGAAAG
AGGAGACAAAGCCAGAGAAGTGTGGAGCAGGGGCAGATCATGTGGGGCCTGGAGATGGGA
GAATACTGAGCAGAAGAATGAGGAGGTCCTGTATATGTTTTAAAGGAATCGCTGTATGTG
TTTGAGATCACATGAAAGCAGAGAGACCAGTTAGGAGGCTACTGCAATAATCTAGATGAG
ATTGTGGTTTAGACTAGGTGTAAAGTGGAAACACCCAGGCAGGACTGGCTACATAATTCA
TGGGTTCTACTGCAAAATGGAAAAGCAGGTTCCATTGTTCAAAAATTATCAAGAATGTTT
TATTTTTTTGAGATAGTCATGCTCTATCGCCCCGTCTGGAGTGCAGTGGAATGATCTCTG
CTCACTGCAACCTCTACCTCCTGGTTTCAAGTGATTCTTGTGCCTCAGCCTGCCAAGTAG
CTGGGACTCCAGGCATGAGCCACCATGCCCAGCTAATTTTTGTATTTTTAGCAGACACAG
GGTTCCACCATGTTGCCCAGGCTGGTCTGGAACTCCTGGCCTCAAGTGATCTGCCTGCCT
TGGCCTCTCAAAGTGCTGCGACTACAGGTGTAAGCCACCATGCCCAGCCAATTATCAAGA
ATTTTTAAGCCAGGCGTGATGGTGTGCATCTGTAACCCCAACATTTTGGGAGGCCAAAGT
GGGAAGATTGCTTGAGGCCCAGAATTCAAGATCAGCCTGGGCAACATAGCAAGAGTCTGC
ATCTACAAAAAAATTTTTTAAATTAGCCAGGCATGGTGGCACACTCCCTGTTGTCCCAGT
TACTTGGGAGACAAGTAGATGGGAGGATTGCTTGAGCCCAAAAGTTTGAGGCTGCAGTGA
GCTATGATTGTGCCAGTAAACTCCAGCCTGGGTGACAGAGAAAGACTTTATCCCCCCACC
CCGCAAAGAAAAGGAAGAAGAAGAGTTTTTAAATGGCGCAGCCCTGGAATCCACAAGGAG
GAGGTTCAGTATTCTCTCCTGAGCGTGAAGTTGGTTCTTGGCATTGCTTCACTGCAACTG
CTATTTGCCATTGATGATTGTTCTTCTCTTCCTCTGAGAGAGTAAGAGGGAGAGGATGCA
TGCAGTCTGAGTGGTTTCTCTTAAAATAAATAAATAAATAATAAATAAAATGGTGCAACC
ACTATGGAAAACAATATAGCAATTCTTTAAAACTTAAAAATAGAATTGCCATATGATCCA
GCAATTCCACTTCTGGGTATAGAAACTTGAAAAGATTTGACAGCAGGGCCCTGAAGAGGT
ATGTACACCCCATGTTCATAGCATCATTCACAATAGCCAAAAAGCAGAAGCAATCCAAGT
GTCCATCAACAGATGAATTTTTTTAATGGGGTCTACATACATACAAGCACATATTATTCC
ACCTTAAAAGGAAGAAAATTCCAATACATGCTAAAACATAGATAAACCTTGAGGACGTTT
GCTAGGTGGAATAAACCAGCCACAAAAAGATGAATGTTGTATGAGCCCACTTATATGAGG
TATCTACAGTCAAGTTCAAATTCACAAAAATGGAAGGGAGAATGATGGTTGCCAGGGGCT
GAAGGGAAGGTGACATGGGGCAGTTGTTTAGTGGCTACAGAGTTTTGGTTTTGCAAGGAT
AAAAAAAGATGAGACTGGGTGCACAACTATGTGGATATACTTAACACTACTGAACTGTAC
ACTTAAAAATGGTTACGATAGTAAATGTTATGTTATATGTATTTTACCACACTCCAGTTT
TTTTAAATTATTAATAATTTCAAGACAGCAACAGCAGAGCACTAAACCAAGCACAGAGCC
CGGTGCAACTGCTCAGGTCGCACACACCTGAAGCTGGCTGGTATCCAGGAGATTTTGAAA
TTAAAGTCAACAGCATGTGCTGAGTAATTAAACGTAAGGTAGGAGAGAGGCAATAGTCAA
GACAGCACTAGGGGCTGGGCACGGTAGCTCATGCCTGTAATCTCAGCACTTTGGGAGGTC
GAGGTGGATGGATCACTTGAACCCAGGAGTTCGAGACCAGCCTGGGCAACATGGTGAAAC
CCCTATCTCTACAAAAAATGGAAAAATTAGCCGGGCATGGTTGTACCCCTGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved