Homo_sapiens Locus Mono:195:AC092590.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:195:AC092590.2
Homo_sapiens
Mono:195:AC092590.2
7
SNORA25L7
1001..1128
2128
AATGTTTATTAAGTATATTTAAATACAATATGCATTTTGAAGTCAAAGTGTAGTTTAAT
TTGGAAGCACATAGCAGGAAACTCTAACCTGGTTTTGGAGAGGATATCAGAGAATGCATC
CCTGACGTTTTAGAGGAGAACGAAGCATGAATAAGACCTAGTTAGGTAATAAGATGGGCA
AAACAAGGGGATGGTGGGGAAGGAATTCTACACAAAAGAGACTTTCAGAGTTCCATGATC
CTGAATTGTGAAAAAAGAAAATGAAAAGTACAATGATCTAAAAGAAGGGGACCATGAAGG
TGATTTAAGAGAAATGCATAGAATAGTGAGAAATGAAAGTAAAGAATGAGGCAGGGACCA
AAGTCTAAAGGAAAGATTTCCTGAATCACATTATTTCTGAAGAGCAAAGAGTGTTAAGCA
AGTCCGTGGTAATATAGGATTTGTGTGTGTGACTGTGTGTGTGTTTAAATATCACTGTGC
CTATTATGTGGGGGAATGGCTCTGTATGTGGGGGGGGGTTGAAAATAACTGAATTAGTGT
TGCTACATTGTGCACTGTTGGGGGTGGGTATGTCATAAGACCACTGCATTCATTTAGTCA
TATCTGAGATTGTGATTTGAACTAGATTAGTTTCATTGATATTGGCAATAATAGGCATTT
AGGTGGCAGACTTGATCAGACTTGGTAGTTGACTGTATATGGTAGGGGAGGAAAGGGGAC
ATATATAATAAATCCCAAGTTTTTGATTAGAAAACCTGGTGGTACCTTTTGTTGAGATTA
TTAATACTGGAAATAAAACAAGCTTGAAGGAAAGGAATGTGTTCAGTTGTAGATACATTA
AATTTGGGATGTCTGTGTGATAATTGAGTAGGGAACTAAAGTAAGCAGGTGTATATACTT
GTAGCCAAGCAGATGGGCTTGAGATATGGCTTTCAAGAGATTTCAGAGTAGATATGATTG
CTTAGAGAGTGAAAAATGGTGTGGTTTTAGATGGAGTCTTTAGGCCATTTTAAAGAGGGC
TCATGGGACTATGAAACCAAGAGCTCTTAATGCTGTGACCAAAGATTGAAGTTCTCTATA
GGTTGCCAAAGCACTCAGTGGTGCTGTGTTTTCCTGAGGAGATATAAGACTTGGAAAAAG
AAAAAAAAAATAGACTGAGTCTCAAGAAACTCTAACATGTACTATTTTGGTAGAAAGGGA
GGAGTAAGCAAAGAAGTCTGAGAAGAATCAGCCAAAGATCTAATAAAAAGCCTAGTGTAT
TTAAAGAGCTAAGAGGTTGCTAGTGAAAACTAAGGGAAGACTAGGAGTTGTCCTCCATTT
GACTTACTGTATGGGGCTGTATTATCTTCCTATTGCTGCTGTAATAAATTAGCACATATT
TGGCAGCTTAAAACAACACAAATTTATTCACTTACAGTTCTGGAGACCAGAAGTCTGGAA
TCAGCTTTACTGGATTGAAGTAAAGGTGTTGGCAGGGCAGACTCCTTCTGAAGTATCTAG
GGGAGAATCTGTTTCTTTGCCTTTACTAGCTTTAAAAATATATATATTTTTATTTTAATA
GCTTTTGGGGTATAAGTGGTTTTGAAATACATGGATGAATTCCATAGTGGTAAATTCTGA
GATTTTAGCACACCTGTCGTTTCTTCATTTATTCGCCTTTTCTAGCTTCGAAAGATTGGC
TGCAATTTTTGGCTCCTGACTTTCCTCAAATCACTACCACCTCTTTTTTTTTTTTTTTTT
TTTTCCTGAGACAGGGTCTCACTCTGCTGCCCAGGCTGAAATGAAGTGGCATGATCATGG
CTCACTGAAGCTTCAACCTCCTGGGCTCAAGCAGTCCTTCTATCTCAGCCTCCCAACTAG
CTGGGAAAACTGGTGTGCTCCGCCCTGCCTGGCTAATTTTTTCTTTCTTTTTTTTTTTTT
TTTTCAGAGATGAGGTCTGATTATGTTGCCCAAGCTTGGCTTGAAATCCTGGGCTCAAGC
GATACTCCCCGCTTGGCCTCCCAAAGTGCTGGGGTTACTGTAAGCCACAGCACCCGGCCC
CAACCTCTTTCTTATGTCATATCTCCTGCTACTCTCCTGTAGCAGCTTTTCCCTCTGCCT
ATTTTAAGGCCACATGTGATTACATCGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved