Homo_sapiens Locus Mono:279:AC007375.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:279:AC007375.6
Homo_sapiens
Mono:279:AC007375.6
14
SNORA32L1
1001..1115
2115
CGCTTGTGTGAATTTATGTGTTTTTAGCCAATGATCTCCAGGGTCTCCCTTAGTTGTGT
CATTCCAGAAGTCTGCCCTGGGGCCCCTGCTGCAGGGAGCACCTAGAAGGGATGCTGGGC
AATGGCAGTGGGGATGGAATGGACTCAAGAGCAGGTGGGAGCAGCGTCCTGTCTGGTCTA
GGGCCACCTGGGAGAGGGCAGGGGCATCTCAAGTGTCCCCATCACACCTGCCCTGTCAGT
GCAATGATCTCAGCCTCAGGAGTGGGGGTCCAGTAGGAGCCATGTCCTGGGGGCCCAGCC
CCAGGGCCTTCTTGGAAGCCTTCAGCAGAGAAGAAACCGCCCCCGCTACTCCCAGAGACA
CTCTACTTCCTCTCCTCTTTGGTGTTAGTTTATGGGAAAGTGAACGCACACCCTTGAAAC
ATTACAGCAATGGGTCTCACACTTTGGTGGGTCACAATCAGCAGCAGGGCTTGTTACATC
ACAGATCGCTGGGCCCTGCCCCAGGGTTTCTGCCACAACAGGTCTTGGGTAGCGCCTGAG
AATCTCTGTCTCCAACAAGTCCCTGAAGGATGCTGATGCCGCTGGGCCAGGGACCTCACA
CTGAGAATCACTATCCTAGACCATAGAACAGGAGAGGGAGGCTCCTCTTTCAGCTCCCTC
ATCTGACCCCCAGACTTTGGTGTGGGCAGCCTCGTGTTTTCAGGATAGGCCCTGGAAAAG
GCAGCCTCAAGCTGATTCTTTCCGTCTCACTGTCTCTCCCACCTGTCATTCACAAAATAA
TTTATTCAGCAAATTACAGTCCAGACTCTGTTCCCTGAACTCAAGGTGCCTACAGGCAAG
ACACAAGGCTCTAGTGGGTACACAGACCCCTAAGAAGACCATAACAAGACCGCATAGCTG
CACTCTGGAGCTCTGTTCAAGGAGTACTGGGAGCACAGAGGAGGAGCTCCTGCCTCAGTC
CTGGAGAATCCACAAAGGCTGCCTGGAGGAGGTGCCAGCCAAGGCAACTCTTAGAAGATG
GATAGCTTCTCTTTTGCTGTGGGTGTGGCCACAAAACGTTTCCCACTTGGTTTTCTATCT
GCTACCTTGCTCTTAGCCAGCCTATTGGGAACATTTTATGAACACTTTATTAAACTGTTA
CCAAAAAAAAAAAAAAAAAAAAGACAAACAGCACTAGATCACTTTAACTGAGCACTTATT
ACCTGCCAGCTGCTGTGCTAAGACTCTGGAAGCACGAGAGCACCTGTGTCCTCACATCAC
CACCAAGAGGGGAACTATTGTCCTTGAGTGAGATTTGAGCCTAGCCAGTTGGCCTCAAGG
CATCACATTTCTAGCCTGAGGACACATGGGCCTCCTACCATGTGGAGGACAGGGCAGAAC
ATTCCGGGAGGAGACCTGGGCATGCATAAAAGCCGAGAGGCAGATGGGGAGCGGGGGCAG
GACAAGATGTGAGCCTAGTTCAGGTCCCCTGGATGGAAATGCACCACCCCTCAGGGGCAG
CAGAGCCAGGATGGGGGCCAGGTTGAAGCCTATTTCTGGGCTCTGGCGCCATCTGTCTAA
ATAGGGCCAGAGCCACGTTGGCTGCCTCGTGTGCTCTCTGAGCACAGCTGGTCCAGTGAT
GGGTGGGAGGCAGATGGCAGAGGCTGTGGGTCTGGCTCACAGGGCCTCACAGGGCCTGGG
GGGCATGAGGGACCTGAGAATCCCTGCTACCATAGTGGGAGCTCTCTATTCACAGGTTTG
CTTGTGATGAAGGTTAGCCCTGCAGGGAGGCTGTGCCGAGGGGCTGAGGGGTGGTGGCTG
GCACAACCTCCATGACTCGTGGTGGATCCACATCTTAGCTCCCTGGCAGTCTCCATGTGG
CTCTGGGGATCATCAGAGCCTCCTCAACTAGAGCACAAACTCCAGGGCAGGAGCCAGCCT
CCTCTGAACTTGCTCCTGCCCCTTGGGTAGGGGATCAGGAAAGCCACACTGATCCAGGCT
GAATGAGGACTTGAATGGAGACCTGAAGCCAGATGATGGAAAAAGAGAAAGTGAACTACA
GCTGCAGCAAGAGGTATTTCAGTTAGACACAAGGAGGCACTGGCCTGGGAGACTGAAGGG
AGTACTAGCTATTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved