Homo_sapiens Locus Mono:44:AC104842.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:44:AC104842.4
Homo_sapiens
Mono:44:AC104842.4
2
SNORD80L1
1001..1082
2082
TTCTTAAGATTGAATCTACACCTGTTGAAAATGCTGTGAACATTGTTGAATAGACAACA
AAGAATTTGGAGCTATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAAC
TGGAAGCATTACCTTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTAT
TCAACATAGTGTTGGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTA
TTCAATTAGGAAAAGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATC
TAGAAAACCCCATTGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAGTC
TCAGGATACAAAATCAATGTACAAAAATCACAAGTATTCTTATGCACCAATAACAGGCAA
ACAGAGAGCCAAATCATGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATAC
TGAGGAATCCAACTTACAAGGGACGTGAAGGACCTCTTCAAGGAGAACTACAAACCACTG
CTCAGTGAAATAAAAGAGGATACAAGAAATGGAAGAACATTCCATGCTCATGGGTAGGAA
GAATAAATATCATGAAAATGGCCATACTGCCCAAGGTAATTTATAGATTCAATGCCATCG
CCATCAAGCTACCAATGACTTTCTTCACAGAATTGGAAAAAACTACTTTAGAGTTCATAT
GGAACCAAAAAAGAGCCCTCATTGCCAAGTCAATCCTAAGCCAAAAGAACAAAGCTGGAG
GCATCATGCTACCTGACTTCAAACTATACTACAAGAATTTGGAATGTTACATAAACATAG
TTGAAAAAGCAGTGACAGGGATTAAGAGGATTGATTCCAATTTTTAAAGAAGTTTTACTG
TTGGCAAAATGCTATCAAACAGTATCACATGCTACAGAGTAATATTTCATAAAAGGAAGA
GTCAATGTGGCAAACTTCATTGTTTCATTTTAGTAAATTTCCACATACAATGATGATAAT
ACAGTTCAGCAGACAAAAACTGATTCGCAATATTAAGTGTTTCACTCATTTCTGATGTAA
AACAAAATGTTACAGCCACTCAAACTTCAGAAACCATCGTCCTGATCATTCAGAAACCAT
CAACATCGGGGAAAGAGTAATCAGGAAAAATACAATAAATAAAAGACACCCGTATAGGAA
AAGAGGAATCCGAATTATCTCTGATTGCAGATGATGTGATTTTATACCTAGAAACCCCAT
AGTCTTTGCCTAAAAGCCTATTGACCTGTTAAAGAACTTCAGCAAATTTTCGAGATATAA
ACTCAATGTACAAATATACACCAACAACATCCAAGCTGAGCTCCAAATCAAGAATGCAAT
CCCATTCACAATAGCCACACAAAGGATTAAAAAAACCTAGGAATACAGCTAACCAGGGAG
GCAAAAGACCTCTACAATGAGAAATACAAAACACTTCTGGAATAAATTAGAGATGACATA
AACAAATAGAAAAACACTCTATGCTCATGGATAGGATGAATCAATATTGTTAAATGAACA
TAATGTCCCCCAAAATTTACAGATTCAATGCTATTCCTATCAAACTACCAATGACATTCT
TCACAGAACTAGAAAAAGCTATTTTAAAATTTATATGGAACCAAAAAAGAGCCCAAGTAG
CCAAAACAGTACTAAGCAGAAAGAACAAAGCTGGAAACATTACATTTTCTGACTTCAAAC
TATGCTATAAGGCTACAAAAACAAAAACAGCATGGTTCTGGTAGAAAAACACACATAGAC
CAGTGGAATAGAATAGAGAGCCCAGAAGTAATGTCACACACCCACAACCATCTGATATTT
GACAAAATTAACAAAAGTAAGCAATGAAGAAATGACTCCCCATCAGTAAATGGTGCTGGG
ATAACTGACTATCCACATGCAGAAAACTGAAATTGCACCCCTTGCTTACATCATATGAAA
ATCAATTTTTGTTGATATACAAAAATAAACTCAACACGGATTAAAGACAAATATAAAACT
CAAAACTATAAAAAACCTGGAAGATAACATAGAAAACACCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved