Homo_sapiens Locus Mono:250:AC090679.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:250:AC090679.5
Homo_sapiens
Mono:250:AC090679.5
12
SNORA45
1001..1125
2125
TCTGCTTTTCTATGTGATTTTCAATACATTTTAAAGGATGATTTTAAAAGGCACGTATT
GTCACCGTTTGCTGATGGAAAGTTTGGAATAGAACATAGCATGATTTCTGCCTCTTGGTA
GCTTTACTCTGTCTAATGCCCTCCTCTTAAGTGTGAGTGGAACCTGCGGCTTGTTTCCAA
CCAACAGAATATAATAAAAGTGATGAGATATATGTAATTATGTGCCTGTGTTACTCTTTA
TAATAGCATATAAAAGGTCATGTCTGATTTATCCATAGTAGCTAAGCATAGCAGCTAAGC
ATACTACACTGTGTATGCATACTACAGTGTAGTATGCATAGCAGCTAAGCATACTACACT
GCAGTGCATGTAGGAGGTTCTCAATTTATTGAAAGAGTGGATAAATAACAAGCACTGTTT
GACTAAATAAATGTTATTGAAAAATTTTTAGCTTTTAGCCTTGTGAAGAGGCTGTTTTCC
TCACTGGCTTTAAATAATCAAAATAATCAAGCTGCCGTGTAGTGAACTTCCCCTTGGAGA
GGACCACATGTCAAAAAACTAAAGGCACCATCTAGCCACAGTCAGCAAGTAACTGGGGCA
GGCATGCTGGTATCCTGCAATAAACTACAAGTTACCACAAGCCATGTGAGCTTGGGAAGA
GATCAAAAAATGGAAAAAGAGTAGATGAGTCTAAACATGCAAGGCATGTGAAGGTCATGT
ATTTAAGCTTAACAAGTCTTGAATTTGCCATATTGGCAATAGATAAAAATAGAAGGCTCT
TAGCTGGGAATGTACGTTAAGAATATTACTGATGAAAGATGAAGAATGTCTAATGACTGT
ACCAAGCAAGAGGGAAAACTACTGTCTCCTGCAAAAATAACAATGAGATGGTTAAGAATC
TGAATCTGGAAACTGAATATGGAGAAAGGAAAATAAAGAATGTTATGGAATTAAATTTGT
GCTATTATATGCCAGAATAAACACTCAAAAGCTAAGTTCGAGCTGACACTAGAGTAACAT
CCTGACACAGCTCTTGTCCTGGTGTGCTAGAGTTCTCGATGAATCTACTGGTCTTGATTC
ACTGGCAGGAGCAGTGACTGTGTTAGTATGCGTATCTGAAACATGGCCTACCTAGATCCC
AGAAGGTGTGGGTTGGGAGGCATCTTTCCTCATACTCATCAGGGAGTTGGTACCTGCTAT
GGTGTATTATAAGCCATTTCTCTGTTTTTCTAGGCCTACTAAAATGTTCTGCCTGGGGAA
GGAAAAGTTCCCAAAGCAGCCTATCATCATGAAAGCCAAATTCTTCAGCAGAAGAGCTGA
GAAGATTAAAAGCGTTTATGAGTATGGGGCTAGTCTTGGTTACTTAAAGTCACATGGGGG
GAGGTTTATTAAATGTTAACAAATGCTTTTTAAAAATAGCTGATGTAGAAAATTCTGTCA
CTTACATTATCAAAAAATAATGAAGTACCAATCTTTTAAAGATGTATAGATCTTTAAAAG
ACAGAAATGACAAAACTTTATTCAAAAACATAAAAGATGATAAACATAAATGAAAATCTG
AAAATCGAATTCTGTTCATATATAAGAGGCTTAATATCATGAACATTACAGTTTCTCTAA
AATACAATCTACAGAGCCAATCTAATTCCAAAAATGTTGATATGGTTTTAAAATGAACTT
GTCAAGAATAATTAGAATGGGCATAACCAAAACAATTTTAAAAGAACAAGGTGGATGAAT
AAATATATCCCTACCAGGATATATTATGTAGTTATACTAATTGTAGTAAAGTATGTTGAC
ATTGGAATAGATAAATGGACCAACTGGTCATAATAGAGAGCTCAGACACAGATTCACACA
ATTGTGGAAAGTTTATACGTGACAGAAGATTTAAGAATTCAGCAGGAAAACACAAATGGT
GATGAGACAACTAGTCTTCTTGTGAAAATAATAATAAGCAGATCTCAATGTTGCTGAAAG
TAAACTCCAGGGGTATTAGATAATTAAATGTGAAAATAAAGATGTTAACTACTTAAAAAG
GATATATACGGAAATATATCAATACCCTTGTAGCAACAAAAAACTCCTAGAGATATTGAA
AAAAAATAGGCTAATGAATTTAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved