Homo_sapiens Locus Mono:91:AL391807.13
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:91:AL391807.13
Homo_sapiens
Mono:91:AL391807.13
6
SNORD3@L38
1001..1188
2188
AACTAGTGACACCATGCCCTGACTGAAAGCATTTAAGTTTCAAACATGCCTTAAACACT
GAGCTAATACATCAAAATGTTTCTTCAGGTAGACTCAGGTCTGCTAGTTTGTGATTCGAG
ATCTTGTCTATGAGATATTTATTAATGAAGAACATGACACTCAAAGATAGGAAGTGTCTC
GCCTAAGGTCAGAGGTAAATAAATCCCATGAATATATTCCAAATGGAATGCACACCAAAA
TAGTTAAATGTCACTATATAAAACCAAATATTATGTTTATTTATCATTTGATGTTAGATA
AACTTCTAAGAGATCATACTGCACTGCTAATCTTGGGATTACAAAATTTAGACACTAATA
TAGGATGTTTATGTGATATACATTTATATTACTATAGTATTTAACATAAGAGCTCTGTAC
ATGAATACAAAGGTGTTAACTTATAATCCAAATCATAAGTATAAATTATTGGAAATATTT
TATTTCCCTAATTAGTATATTCAGAATAAAGTATTTATAGTTATTAATTTGAAGAATTTA
AAGAGATATCCAAGCAAAAACATATTTAATATTAGAAAAATGAAGCCCCAATTAGCAATG
ATGATGTTCATGATAGTTTAACATTATCGTGTAACTATCATGGTATGTGGTACTTGTCTA
AACACTTTGCATATGTTGGTCAGCTCCATTAAACCCCAACAGAGCTCTGTGCAATAGGCA
CTGTTATTGTTGTTGTTGTTTTCCTCCAGAGATATTCAAGTTATACCAAAATACCTAAGG
TCCGATAATGTTAATTTAGATAAAATTATTTTGAGGAATATATTTTGGACTCCAATTAAA
TACTTCAAAGAATTAGCATCTTTTTTATCTTTTCTTCCAACTCTTGAAACCCAATTGGCA
CAACAAAACAAATATAAAGAGAAAGAAAAACTATCCATTTACAGCAAAGAAATGAAAATA
CCATGACCCCAAAACACAAACTACAGAACCTACAAAATACCAAGACTATACTTTCAGGGA
TCATTTCTATAGTTTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAGAACCTA
CAAAATACCATGAAATGAGAAGTGATGATAAAGAGTGGTCCTTCACTCTTCACCTTTCAA
GAAGGACAGCATTCCCTAAAGTATCTTGGCCAGTAAAGAAGGCTGAAGGTGAAGCCTGGT
GAAGGTGGGAGGGGAGAGATCTCGTGACTTAAAGAATCGAATCCAATTACATACACAGTA
CATGAACACCAAAAACTGAGAGATGAGCTCCCACCCAAAGATTGAGTAAGAATGTGTATA
AGACTAAACTCTGATGGAAGCTGCTGCAGTCCACTCACTGTCAGCCACACTCTCCTTGTG
CTCACTTCCCTCCAAAAGCCCCCTTCACCCTCCCTTATGCAATATTTCAGACAAATATTT
GGAGGCAGTAAAGTACAGTGGTGAAGGCTCTGGAGACAGCCTGGGTTCAAATCATCATTC
TACCACTGTGAATCCCTGGGCACGCTTAACTCTCTGCACAACTTTCTTATATAGGCCAGA
AGAGCATAAAAATAGTAGGATTCAGAGGTATCTATCTTAGTCAGTTTGGGCAGGTGTAAC
AGAGCACAATAGCCTTGGTGGCTGATAAACAAAGGAAATGTATTTCTCATAGTTCTGGGA
GCCAGAAGTCTGAGATCAGGTTGTCAGCATAGTCAGGTTCTGGTGAGGACCCTCTTCCAT
GTTCTTAGCCATTGACTTCTTTATGACTCACATGGCAGAAAGAGAACTTGCGAGCTCTTT
GACCTCTTCTTGTAAGGGCAATAATCTCATTCACGAAAGTTCCATTCTCATGAACTAATT
GTGACCCAAAGTCCCCAGCTCCAAATATCATCACATTAGCATTAGGATTTCAACATATGA
ATTTGAAGGATGGCAAAAACATTCAATCTCTAACAATATTTTATCCTAAATATAATATCA
AACACATCTCAAACATTTTCATACTACTAAAAAAAAATCGGTATTTGAGAATGAGGGTAC
ATCAGCTTTCAGTAATGATGTTACCATAAAAAATGTGCTTAAAATTATTTATTACGTTCT
AAAAATGTAGGATGCTATGAGAAATAAAAGTAAATTAAGACAAATGAGAACACTTATCAT
TTTAAAAACGACAAATATCATTCAGCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved