Homo_sapiens Locus Mono:106:AC020593.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:106:AC020593.6
Homo_sapiens
Mono:106:AC020593.6
4
SNORA70FL2
1001..1141
2141
AAACTCCTGGACTCAAGCGATCCACCTTCTTCAGCCTCCCAAACAGATGGGATTACATG
AGCGAGCCACTGCGCCGGGCCTCAGCTACTTATATTAGGGTTCTACAGAGTATGGCACAT
GCTTCCCAGAAGCATTATGAAAGTAAATATGTGGATTGACAGTGGCACCCTCCCTTTATC
CAGATGTCACCTGGCTTTGTGTGGTGGTTGTACCGTACACGGAGGCACCCGAGGGAAGAG
TGGGAGTTCCAGAAAAGGTGGGTTGATGGTGGTTTCCTCACTCTTTTGCTTTCAGCACAG
TGTGATGCATTACAGTTTATATATGGTCAGCTATATTGTCATAACTGGTTTTTAGATAAT
AGTCTCTAATTTTAATTAAATTAACTCTCGTAAAAACAGACAAATGACCTAAAAAGATTT
CCTGCAACATGTTCTCACTCATAGGTGGGAATTGAACAATGAGAACACATGGACACAGGA
AGGGGAACATCACACACCGGGGCCTGTTGTGGGGTGGGGGGAGAGGGGAGGGATAGCATT
AGGAGATATACCTTATGTTAAATGACGAGTTAATGGGTGCAGCACACCAACATGGCACAT
GTATACATATGTAACTAACCTGCGCGTTGTGCACATGTATGCTAAAACTTAAAGTATTAA
AAAAAAAAAAGATTTCCTGCAAAGAAACCATGGATTGACGTGAAAACAATAACATGAGTA
GAAGCAAAGAAGCAACAACAACAAAAACAACAATAAAAAGAGCAGACCAGTTCTACTCCT
AGAAAAAACTCTTTGCTACCCACATTGAAAGGCCAAAATAATAAGGCTCAAATGAGATTT
GATGAGAAGTCTGACAAAATAGTCAAAATTAGCAAGGAGATGGCTTGCAAGTTGTATTTA
CATCCATTATCATTAATGAGGAACCACAACTTAAGGGAATATTTTGCCTTGAAATATTAA
TGATTGTAGCATGATTTGAAAGACATTTAAAATAGTATTTCTTACAGTCAATTAAGCCAA
TCATGTTCCTTTCCTTGTAAGGGCCAGGTGTGCCATGGCTGCGAACAGCAGCCTTCTCGG
TAGTATGTGCACCGTGTTGCTTGTATGTTGTAAGCATTGCCCTAAGGACCTTGGAGACAG
CCCTTTCCAATGGACATTCATGTCCCTGACCTGACACTGTCTCCAGTCTGTGCTCTAGAT
AGGTACGCAGGGTGCCTTTGAAAGCCCCAGGGCATGGGAGGAAAGATCCACATTGGCCAA
GTCATTATGTTCATCTGCACCAAGCTGCAGAACAAGGAGTATGTGATTAAGACCCCACAC
AGGACCAAGTTCAAGTTCCCTAGCTGCTAGAAGATCCATATTTCAAAGAAGTGAGATTTT
ACCAAGATTAATGTGGATGAATTTGAAGACATGGTAGCTGTGAAACAGCTCATCCTAGAC
AGCTATCAGGTCGAACACCCCCAATCATGGCCCCCTGGACAAGTGGTGGGCCCTGTACTT
ATGGGGGCTCCCACTGTTTTGCCCCTCCTTATTCACACCCACCAATAAAGCCTACTTCCT
AACCCCCAAAATAAAGAAATAATAATATTATTTATCTTTATATCATCTTTTAGTGTCTTT
TTTTGTGCACGTATTGTAATGCTTGTAATACATTGGTAAGTATACATAATGGAAGTATGG
GCTGAACATTTTTTGCTGATTAGAGGGTCACAATCAAAAAGCTGGTGACCACTGATTTGT
ACTGAGACTGACATGTCCAGAAGTCCATCCAACTTATGAAGAAGACATGTGGATGGTGGC
ACAGCTTGGACTCTGTAATTCAAGACTGTAAAACATTTCTCACTCTACGTTTTATGACCT
ATAACACACGATTACATGAACTAGGGAAAGGATTGTGCTTTAGAAAGTCAGGTAAGTGTA
TTTGCATTTCCATTATCAGGAAAAACTCCCTCCATCCTCATTCCTCAACTTCTAGGTTTT
TCCTAGGACTAGATTTAGGGACTAGATTTAACAATCTTTCAATCAAGTTTGTTTTCTTTG
TTACTTTCACCTGGTTCGACATCTAAGTAAATCAACATTGCTAATCTGTTAGTTTTTTTT
TTTTTTTTTTTTTTTTTTTGAGATGAAGTCTCGCTATATCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved