Homo_sapiens Locus Mono:133:AC116353.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:133:AC116353.2
Homo_sapiens
Mono:133:AC116353.2
5
SNORA27L1
1001..1126
2126
TCCTACATGTGTAAATATAAAAGCCCATAATATTGCATTTTTGGTTTGTAACTCCTCTT
TTTTGCCTATATGATTTAAAAAACAAATGCATAAAACAATAATTGTAAACCTATGATAAT
GGGCACACAATATATACAGATATAATTTGTGACATTAGCAACATAATGGGAAAATATGCA
GATGTATGGGGTAAAATCTTTATAGATATTGAAGCTAAATTGGAATTAATTCAAGCTGGA
TTGCTATGTGGTTTTTGTTTTGTCTTTTTTTGTTTGTTTGTTTGTTTGTTTGTTTTTAGA
TGAGGTCTCACTATGTTGCCCAGGCTGGTTTCAAACTCCTGGGTTCAAAAGATCCTTCTG
CCTCAGCCTCCTGATTAGCTGGGATTACAGGTGCATACCCTTGTGCCTGGTGAGACTGTT
TTAAATTTAAGATATTAGCCGGGCGAGGTGGCTCACGACTGTAATCCCAGCACTTTGGGA
GGCTGAGGCAGGCAGATCACGAGGTCAAGAGATCAAGACTATCCTGGCCAACATGGTGAA
ACCCCATCTCTACTAAAAAATACAAAAATTAGCTGCGCTTGTAGTCCCAGCTACTCTGGA
GGCTGAGGCAGGAGAATAGCTTGAACCCAGGAGGCGGAGGTTGCAGTGAGCTGAGATCAC
ACCACTGCGCTGCAGCCTGGAGATAGAGCGAAACTCTGTCTCAAAATAAATAAATAAATA
AATAAATAAATTAATTAATTAAAATACATTTAAGATATTAATTGTAATCTCCAAGATGGC
CACAAGGAAAATAAGTGGGGTTTTTTTGTTTTGTCTTGCTTTTTTAGACAGGGTATCACT
CTGTCACCCAGGCTAGAGTGCAGTGGCACGATCATGGCTCACTGCAGCCTCAACTTTCCA
GACTCCAGTGATCCTCCCACTTCAGCCTCCTGAGTAGCTAGGACCACAGGCCTGTGCCAC
CATGCCTGGCCAATAGAAAAATAACCGTTAAAAATATGGAAAAACCCCTGTTCACTTTGC
CAAATGGATTTGTGTCTTTATTGCTCATTAATTGGGGCAAAGGAAATATCCTTTTAAAAC
TCAGGCAAACTGAGTGTTTGTCTTGTATCCTGTCAGAGGAAAGAAATTGAAAAAGAATAA
AAAGGAAAAAAATATCAAAAAGGTAATGCGAAAAAAATCAACACAGCACATTGCAAAAAA
TCAATTAAATACAAAAGGCAATATTAGAGGAATTAAGAAACAAAAATATATAGCCAAATA
GCAAGATGGCAGGAGTTAGTGTTTGTTATCAGTGATTACTTTAAAGGTAAATGGAATAAA
CTCCCCGATTAAATAATAGAGTTTGGAAGAATAGTTTTTTTTTTTTGGTTGGAAGAATAG
ATTAAAAAAAAAACCCTTAATTTATCTATGTGTTGTCTACAAGAGACTCATTTTATTTTC
TTTATTTTTTTAAGAGACAGGGTCTCACTGTGTTGCCTAGGCTGGAGGTACAGTGATGTG
ATCATGGCTCACTGCAGCCTCAACCTCCCAGGCTCAAGTGATCCTCCTGCCTCAGCCTCC
AAGTAGCTGGAACTACAGGTGTGTGCCACCATACCTACTTATTTTCATTTTTTTGTAGCT
ATGGGATCTTACTATGTTGCCTAGTCTGGTTTCAAACTTCTAAACTCAAGTGATTCTTCC
ACCCTGGCCTCCGAAAGTGTTGGGATTACCGGCATGAGCTGCCGTGTCCAGCCAAGACCC
ACTTTAGATCCAAAGACACAAATAGGTTAAAAGTAAGAAGATGGAAAAAGATACAAAAGA
GTCTGTGGTGGCTATATAAGTATCACACCAAATAGACTGTAAGTCAAAAATTGTTACAAG
AGACAAAGAAGTATATTATATATTCATAAAAGGTTCAATTCATCAAAAAGATAAAACAAA
TATAAACACGTATGCACCTGACAATAGACCAAATATGTGAAGCAAAAATGGACAGAAATG
AAGGGAGAAATAGATAGTTCTACAGTAATAGTTGGAGACTTCAATACTCTACTTTCTTTT
CTTTTCTTTTTCTTTTTTTGAGATAAGATCTCACTATATTGCCCAGGCTGGTCTTGAACT
CCTAGGCTCAAGCAATCCTCCTGCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved