Homo_sapiens Locus Mono:197:AC003109.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:197:AC003109.1
Homo_sapiens
Mono:197:AC003109.1
7
SNORA26L5
1001..1122
2122
GCTAGTGGCATATTGTTTCTGAAATATTAAGGAACTGAGAAAAGATTTCCCCCATCGTG
TGGCTTCTGAGAACACCACGTGTGTGGGGGGGCTCAGGTGTGCCATGGGAGGGGTTTTGG
TCATTAACCCGCTCCTTCTCCAGGATTCGACTGCTCTCCCACGTGGCTGGCTGCAGGGCC
CGTAATGAAGCTGACAGCTCTTCCAGGCACGATTTTTCTTCCTTAAAGCATGGCTTCTTC
GGAACAGAACCAATCAGAGTTTTATTTTATTCCGGTTCTGTGAATTGGTTGTGGGATGAA
GCTTCTTGGGTGCGGGAGAAAAAGTGCCTGGATGAGGGGTTGAGACAGCACGTCACCACC
AAGCATGTGGCATGGTGATAATTCAGTTGCAACCTTAGCGAGGACATACTCTGTGTTCAG
CATTGCGGAAGATTCAAAATGAGTCAGAAAGGTCATTCTTGCTGTCCCAAGTACCCTATT
AACCCTTTTAGCTCAGTACACTATTAACTCTTTTAGCATATATGTGAACTTCCTAGACCT
CAGTTTCTCCATCTATAAAATGGAGCAATAATAATACCTCCTTCAGTACAGTTGAGGAGA
TAAGATAGGGGACTGGGAGGCAGTGGTGGGCATCTCTGATTCACCCACAGAGGGGATGAG
GCTGAAGGTTGGAGAGAGTGAGGCAATAATGGAAGTAAAGACATCAAAAGCATATTTTAG
ACTCTGGTTCGTTTGGGGCAGGAAGGAAGAAGTTTAAGATGGGTGAGGATGTATTTACAT
TTGTAGGATACTGATACCAGACTGAATTTAATACAGGTTCACTGTCTCCTTAAACATAAT
AAGCTGGACAAGAAGCAATAACAATCTGTTAGTAAGGAACACCGTAATTCAAAGTTCTAC
TGAAAGGAACATGGCACCTTGGAAAACAATTATTCCAAGCACGGGACAGAAGAATGTCAA
AGACTAGTAGGGCAACTCAGAAGGGCACATGACCCTTTCCTGCACCCCTTTAAGGCTGAT
GCAATGCTTTAAGAGGCTAACGCAGAAGGGTGAAGCCAGTCTCCTTAAAACCCAAAGAAG
AGATTGTAAAACTTCTCTTTGGATCCTGTCTGGAGTCACAGCTGGAAAAAAAAGGAGCAG
GGGTCCTGACAGAACAAATTTGAAAAGGCTATTATTTTATTATTATTATTAATTTTGAGA
CAGAGTCTCACTCTGTTGTCCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGCAAC
CTCCGCTTCCCGGGTTCAAGTGATTCTCCTGCCTCGGCCTCTCGAGTAGATGGAACTACA
GGCACACACGCCACCACGCCCCGCTAATTTTTTTGTATTTTTAGTAGAGAGAGGCTTTTG
TCATGTTGCCCAGCCTGGTCTCAAACTACTGGCCTCAAGTGATCTGCCCACCTCAGCCTC
CCAAAGTGCTGGGGTTACAGGCGCAAGGCATCATGCCCGGTGGAAAAGGCTATCATTGGT
TAAACTTGGGTTAACTTTAGCTTTAGAAAGTAGGACTGCAAAGATTGAAACACATCAAAC
ATAGAAAAATCCATGAGTTCGTAATGATATTCCAAAAATATTTTCATAGTTAAAGGTGCT
TAAGGAAGCAACTCATTAATTTGATACCAATAAGGGGAAGGAATCAAGTATTTATCCTGC
CTTTGCAAACATGACGGGGGAATTCTTCTCTATAGAAGAACTATAGCTAATATATGCCAA
AGGAATGAAAACATTAGAATGCTGCCATTTAGTAAACCCTAACAAAATCATTCTAGCCAC
TGATTATCAATATCTGCTAAAATTATTGGGTGAAATGTTAATAGGGAACTTTAGAATAGA
TGGGTCAGGCTGACAACATTTGAACTCTGATCAGTTCTAACATTATTGGATAGTGAGAGA
TTTTGTGCCTCCTGAATAAAAAGCAAAAGCAAGTTCACAGCACCACCTATAAAGTATTCT
TGGGTTTTTTATTTGTTTGTTCTTTGTATTTCTTTGTCGCTCTGTCACCCAGGCTGGAGT
GCAGTGGCACGATCTTGGCTCACGGCAATCTCAGCCTCCCAGGCTCAAGCGATTCTCTCA
CCTCAGCCTTCTGAGTAGCTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved