Homo_sapiens Locus Mono:80:AL022724.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:80:AL022724.2
Homo_sapiens
Mono:80:AL022724.2
6
SNORA67L6
1001..1142
2142
AGGCTCTCCTTTGAGTCATTAGGGCCATCTAGTCATCCACTCTAGAGCTTCCCTGCACG
CAAGCCATTTATCCTCCAGGCCACTCCTCATCTCCTTCTCCTTTTCATCAAATGTATCTG
CTATGCGTCCTATTCTATCAATGTTCATTCACTACCAGTCCACATGAAACTGCAATTTGC
TCGTCACTGTAAATAGAATTGTGGTATGTAAGATGGAGAGAGTATCTGAAATGAAACAAT
AACTCTAATGTTGAGACTATCAGCTTCCAGGGAAGCCTAGGGTGGAAGATAACTGGTGAT
GATGCCTGTAAGGTTAAGAAGCTATAAGGAATCCTCAAGTCCGCCTGTATTTTTGAGTAC
TTTCTAATGGTGCAGAGTTAGGCTTTGTTGGAGATATAAAGAGGTAGACACGGCCCCTCA
TCCCGGGAGTTTGCAATCAAGCAGGTGGGATGGTGAATTAGGCCATTCTTGCATTGCTAT
AAAGAAATACCTGAAGCTGGGTAATTTATAAAGAAAAGAGGTTTGATTGGCTCACAGTTC
TGCAGGCTTTACAGGAAGAATGGTGCTGGCATCTCCTGGGCTTCTGGGGAGGCCTCAGGA
AGCTTACAATCACGGCAGAAGGTGAAGGGGGAGCAGGCACGTTATATAGTGAGAACAGGA
GCAAGAGAGATGGGAGGAGGAGGGGCCACACACTTTTAGACAACCAGATCTCGCCAGAAC
TCACTATGGCGAGGCCAGCCCCAAGAAGATGGCATTAAATCATTCATGAGAAATCCACTC
CCATGATCCAAACACCTCCCACCAGGCCCCACCTCCAACACTGGGTATCATGATTCAACA
CGAGATTTCGAGGAAACAACACCCAAACTATATCAGACGGAGATCTTGGGAGCCAGGCAC
TTGCATCCACCACTTTAAATAATCTTATTATTTAATTGTGGTGGTATCATTATCTAACTT
TGCAGACAAGGAACCAAGGCTCAGAGGAGTAAACTATTTTTATCCAAGGTGAGTCTCTCT
CCAAGGGGCTGACTAGTGCCTCTCTTAGGACAGTAGCAAGTTGGAATAAAATCTGGCATG
CCTAAGGTCTTTAAGGAACAGGGGATGCTTACTTCTTTTGCGTTCCTCTGGCGGCCTACA
TAGCATACTTAAGCTCCTTCTGGATAGACTGTGTCCTCTTATTCACATGCTGAAGTTGTT
ATATATTTTTAAACAAATAAAAAGTGAATAATACATTTTTCTAAAAAGTAACTGATTTTC
TCTAGGTTCCATACAGATAGCCAGCCATGGGAGTCAGAATTTGAACTCAGATCTGGTCTG
GTTCTGAAGCCTCTCTTCTTTCCAGCTGTGAGACAAAGGAGCAAATATGAGAAGCACCTT
TTGCTCACTTCTGCTTGCCAGCAGAATTTCACAAAAGCCCTGGACTGTGAAGATGTTTGG
AAAGATGCTTTGAAGACAAAACCTTTAACAGGGTTAGTGTTTATGCCTCTGTAATCTACA
ACCGGATGCGCTCTTACACCCAAGCCTTGATGGGATTCTGCTGCGACGGAAATTCTGAGC
AAATTTGATGTGATTGTGCAGGTACTGAACCTCCACTTCCTGTCTGTAAGCAGTGGGCTG
AAATCCTGGGCTGGAGCAGTCTCATAGGATCTGACAGGCTGTTGCCAGGCTGTAGGCCTT
GGTCTGTAGTCCTCAGTAAGACTTCTGAATACAACTAACTTTAATTCTTTAAAAGCTTGA
CTGTTTTCTTTAGTCGGCATGGCATTCCATACCATTCCAGAAACAGAAGCCAGGAGGATA
CGTGAAGGAGAGAGCAATGGCATAGTGTGTGAAGCTGATTAGCTGTTAACTAGCAGAACT
GAGAGAAGGCAGCCGGCCAAATGCCCCGGAGGGGCAAGGAAAAGCTTTTTCAGAGAGTTG
GGAAGTGGCACTCCAGTGAGGTCGGAAGCCATGAAGGTTGACTTATTTATTCCACAGTAG
CTACAAGAAGAGGGGTCTTTCTAGGGAGTGTGACCAGTTTAAGCAAAGGCTTGGGAGGAG
GAATAATAACGTGCTGGAAGTGGGAAAGGGGACCTGGTTAAGGGGCTGAAAGTTATTCCT
TGTGGATCACCTTCTCATCACACGCTCTTTGACCTCATTGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved