Homo_sapiens Locus Mono:311:AC023950.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:311:AC023950.6
Homo_sapiens
Mono:311:AC023950.6
11
SNORA1L3
1001..1136
2136
ACCTGATCATTAAGCGGTGGGAGTGCTTAAACAACAGTAACAAGCCCAAGGTGGCTGAA
GCAGCTGGTATGTGACCAGAGGAAGATGCAGATGAAGGACAAGCAGAGGATAGTCAATGA
AGATAGGCGCTGAATGAGCAACAAATCAATATTGAATCAATCAAAGGGATGAATATGGGT
GCCTCTATGTGGCCTGCTTCAAGCTAGATTCAATGATGATCCAAACGTACGTGGATGCTG
GCCATGCAGATGTTATTCTGGGAGGGAAGATCAATAAGTGTGATAGGGGTCAGGACTTAA
CTGTAGATGGGGCTTGTCTCCTTAGCTTTTGCTCATTGTGGCCTCCATAGCCTGCCTTGG
AAGCTGAATGGCCAATGTCTAAAGTGCATGTGCAATTATGACAGCGTCCACAACAAGCAG
CCAGCCATCTGTATATGCTGAAAAGCCAGGCAGAACTCTGCTGTGGGTCTTGGGGTCCCA
GGAAGCAAAGAGATCTTCCATTTCAGGACCTCAAGATAAAGTTTCTCAAGGTCCTCCCAA
GGCTAAGCCCTAGCAGATACTGAAGGCAAACCCCTACTTTTTGTGGGTTATAGGGTCCCA
CAATGGTTGTTCTGGACCGTGGAATTTTATCTTTCAAGTCCTGATCCCTATCACACTTAC
ACTAATTGATCTTTCCCCCTAGACAATAACATCCGCATGGTCAGGATCTACATCTGTTTG
GGACATCACTGAATCCAGCTTGAAGCAGTTCACATAGAGGTGCCCATATTCAGATCCCTT
TGATAGATCCAATATTGATTTGTTGGTCATCTGCTATTCTCAGGTTAGAGGTGAGGAAAT
AAGACTGTTCCTAAGTAGAGAAGAGACAACCATGGCACACTGCACAAAGGGCAATGACAG
TGCCTGACCATCTAGACAAAAAAGAATGAGAAACTATCCTGGACCGTGACAAATGAAGGC
AGTCACATATGCATAGCTTATCCTAAGAACTGTGAAGGTGATGCCCCATTCTCAAAGAGA
ATAGGCACTGTTGATCATGCGATCCAGAGATTGTTAATGGGGCTGCATTGAGAAACAAGC
TATGTTTCCATTCACAGCAAACACATCGCAGTGGTGACAATGAGACCTGTAACATTTCTG
CTAAGGTCACGAGTGAAAATGGGATGCAACACAACCTCAACATTAGAAAAATATTAAAGA
ATAATGCATTTTTGCTCATTAGCCAAAATAACAATATGCTTTCTACAATTCAACTGCTAG
GGCCCTAAAGTGAATTATTTGAAGAATTAGACCCTAAAGATTCTGTATAGGAAGTTTTTA
AAGTATTTCATCAGTATGTCTGTATTGAAGTGGAGACAAAAGAAGCCCAACTAAGATGGA
CAGAAGGACTGTGGATTCAGCATGAATCTCTAGAAAGGCCTATCTTGAAGATAAATCTTG
ACTCAAGATTTGGAGGAACTAAGATGACCCTGATGGGCAGTGGAACGAATGACAACATGT
AAAATTCCTTAAATAAAAATGTATTGACTTAAAGAAAAAACCATAATGGTGGTATTTGGT
TGTTTGTGAGCTTTTGCAGTCAGGATTGTTGCTCAAATACCTTCCTCACTTCTCCATATC
TGCCCTGGTTTGCCTTTACCACACTGTCCCCCAGGGCCTGGCTCAGTTGATGCTTTTGGA
AAATGGATTTTGAGCTGTAAAAGACAGCTTTTCCAGATATAAACTCAAGCTTCTGAAGCA
AGAATTGGATTAAAAGGAGCAACCGAAAAGGACCTCAGAGATCCTCTGGGACAATTGCTT
TTAATCTGGGTTTCCTGGAGCTTAAAGGTTCTGCAGAGGTGCCTGGGGTGCGGGGAGCTG
GGAGGCAGTCCTGGGTAAGGGGGATGCTAAAGTGGCAAGGCTCAGGGTCTCCACCTTCCA
GCCAGAAGAGCTCAATGTGACCTTTTTCACCCACTGAAGTTCCAAATCTGTTAGGAGAAA
GATTCCAAGGTTTAAGGTTTAAAACCCCCTAAGCTAGTCCAACACCATCATCGTATCATA
ATTTTAAAAATAGCTGATTTTGAGTGTTTAGTGTGTGCCAGGAACCGTTATAAATGCTTT
ACATGCATTACCTCATCTAATCCTCGCAGCAGCTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved