Homo_sapiens Locus MEG8
snOPY snoRNA Orthological Gene Database
Homo_sapiens MEG8
Homo_sapiens
MEG8
14
SNORD112
4151..4227
14199
GGCCTTCCTTTTATTATCCCCATTTTTCAGAAGAGGAATCCGAGGCCTTGGGACCTACA
CCCACCCTCACACCCGGGCCCACGCTCACTTTAATAACCCGGACTGGGCAAGGACTAAGT
CCAGCCAGAGCGTCAGCCTCGCTGGCGTCCTCACTGGCCATGGCCCTGCAGCCTTGCTCT
TCAGTTCCTGGAAGCCTCCTGCCCTTGGTGGACAACCATTTTGCTCTCTAGCAAATGGAT
AGAAAAGTTTATGTGAGTCTGGCTGGGCGGGGTGGCTCACACCTGTAATGCAGCTCGTTG
GGTGGCTGAGGCAGGCAGAGCATTTGAGGTCAGGAGTTCAAGACCAGCCTGGCTGACACC
GTGAAACCTTGTCTCTACTAAAAATACAAAAATTAGCTGGGTGTGGTGGCGTGCGCCTGT
AATCCCAGCTACTTGGGAGGCTGAGGTAGGAGAATTACTTGAATCTGAGAGATGGAGGCT
GCAGTGAGCCGAGATCATGCCACTGCACTCCAACCTGGGCGACAGAGTGAAACTCCGTCT
CAAAAAAAAAAAAAAAAAGAAAAAAAAAGAAAAGAAAAAAACGTGTATTTGAGTCTGGGC
CCCGGCCTCTGTTGGACTTTGAGTAAATCTTAATTTAGCACCCTGAGCTGCAACTCCTTT
CTCCTGACCCTGCCACCTGCATGCGCCATTCAAGTGGCTGCGCCCCAGGCTGCTCATCCC
TTCCGCCCTGGGTCCCCATACACAGCAACCCCATGGGGTTTTTGTCCTGCTCCTTCATAT
TAATCTGCATTGGTGACTCCTTTGTCCCATCTTCCCTCAGCACACAGTAGGGCTGCTGGC
AGCAGGTGAGGCCTGGGGCAAGGGCTCAGAGAGGCAAGATGCCATTTGGCCATGCCACCG
AGTGAGCAGTTTCTCTTCTTGCCCTCCCAGGTGGCGTGAAGGGGAGATGGCTGCTTTCTC
CTGGGAAGGGAGCAGATGCCTGGCCCAGGACCAAATCAAAAGGTCTGAAAAATGATATTC
ATTGTCCTAATGTGTAAATTTCGACAATTTGCAAATTTGTAGATTCTTTAGAATAGAACT
AACTCAAGCCCTTCATTCTGCAGCTGAGGCTCACTGCCCCCAGTGGGCAGTGGGTCCAGG
GGGTTTCTGAGGACAGGGCATGACCCAGCCCTGCTGCCCCCAAGATGGCACCTGGCTTGG
AGGGGTGAGGGGCCCTGTTAGTCTGACTTTGAAGAAGACCAGCCTTCCAGACTCGCTTGG
TGCCCTGACAGGTATGTGTGCTCTTCTCTCTCCCACCTAACAGCCCCTTTTGGGAGACAG
GGTCTGAGAGGAGTCAGGGTCGTATAACCTTAACACAGTGTGTTATCCAAAAACCCACTA
ACCCTGTTACTCTTGTCTGTCTGCTATGTGAAACCAAGGGCGGTGTTAAAGTTTATCACC
ATGATATACAGATGTGCGTGGGGACATCTGGGATGGGGCTCAGGGGTCTACCTGGAGGTC
AGAGAGGGCAGGATCTGCTTAGGGGAGATGGATGACTGTGGGGGTCAGACAGGGCAGGGT
TTGCTTAGGGGAGATGGATGACTGTGGACATGTGGCTGTAAATCATCCTCCCCGTCTTAC
ATAGGATGGGGATGCAACTTTCAAGAGTTGCCTTGATTGGTACCTTAAAGGAAATAAAAC
ATAAAATGCTTGGCACATAGTAGATGCTCAACACATGTAGAAAAGGCACTTATTTTAGGT
GGATCTGCCGCCGAATGGCCCTTTTGCAAGCTCTTCTCATTTTTTGGAATCCAAAGGGAA
GGTGTGGGGAGCAGGGTCGGGGTGGAGGGGAAGGACGACGTGAGGTTGCAGAGGGCATTT
TCTTGAGGCAATGGCATATCTTTCATTGGTACTGGCTGGGTTTATGCGGACTTTGAGAGG
AGTGGAGTGTCTCCAAGTGGGGCTACCCCAGCCTGCAGGTTGGATGCAGGTAACCTCAGT
CTGGGCACTGCATTTTTATTTACCATAAAAATATTTCATATTTGCTGGGTGTGGTGGCTC
ACGCTTATAATCCCAGCACTTTCGGAGGCCGAGGCCGGTGGATCACCTGAGGCCAGGAGT
TTGAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACAAAAATACACAAAATTAGC
TGGGCGTGGTGGTGCATGCCTGTAGTTCCAGCTACTCAGGAGACTGAGGCATGAGAATTG
CTCGAACCTGGAAGGCAGAAGTTGCAGTTAGCCGAGATTGCACCATTGCACTCCAGCCTG
GGTGACAGCAAGACTCCGTCTCAAAAAAAAAAAAAAGAAAGAAAAATTGCAAAACTATAG
CAATCACCTCAAGGTTTTCACAGGAATCAAACTCAGTCCAAACTAAAATGCTGTGTAATA
AATAGTGGGGCTTCACGTGCAGGAAAGGCGATTAAGAGCGAGGCATGCAGGCCGAGGGCT
GCTTAACCTGTCTCAGATTTCTTCCGCACAAAGTCATGGTTGAAAATAGGTCTCTGCCTG
GCAGAGGGTAAAGAAGTTCTCGAAGGCCTCTGTCTGCATTAGCTTGGTGAGAGGGAAGAC
ATTTAACCAATTAACCAATTAGTGATCTGTGCGGATGGAGACTGAGCAGGACGAGGGTGC
CACCCGACTGGGTGTAAAGTGGGCTTAGTTTTGTCTTCTTGGTGTCTGGGAGCCTCAGTG
CCTTTCTACGTAGATGGGAGTATGCTTGTCACATCCTTGTCACACAAGTAACCCTGTGCC
TGTTTGAGGATTCCAAGAGCCTGTGACGGCTGCAGGGGGCCCTGAAGCTTAGTGTGCAAG
CAGGAGCTGGGGACAGAGGGGCTTCTGACGGGAGTCGGGGTGCCTCCTCTGGATGTGGGG
GTGGGCTAGGGTGGGCAAAGGTTGCTTCCCGTTCTCCTGCAGCTGACAGTTAGAAATGCC
AGTGCCGTTTAGCCACAGTCCCTCTGGGTTAGAGTCGGGAAGAAACATGGCAGTTGTGTG
TTTTGCACAGGAATCAAGCTGTCAGGGGGCACAGTGAGGCCCCAGCTCCTTACCAGCAAG
CCGTCTAGGCTGCGAACGCGAGCCGCCGGGCCGCAGCTCTCTAGAGGTCCCTGTCCCCAC
CGCCTGGCCCCATCTCATGTCACATTCCCCCAAGGTCTCATTCCACTCGGCTAATCTCCA
AGAACACCGGCCAGGGCATTGGCTTTCGGGTCCTTTTAAAGACCAAAAAGTAAAGCACTC
CCCCGTGGGTGCTGGACAGCTTGGGAGGGATTTGGGGCTGTGGGTGGTGAAATCACAGCC
CTGGGCACACACCTGCCAGCCCGATGTCACTGACAGGCTGCTCGGAGGCTTGGGGCTCCA
GTGAGAGCATATAGATATTTTTTAAAAAACATATTCGCGATAAAATAAATCCCCTGTGTC
TGCAGAACTTGCTCTGGGCATGTACCCACTCCCAATCCATCAGGAAACATGCCCTTTGCT
TTGTATTTGTAAAAACAGAAACAAAAACAAAAACAACCCACAGGCGAACAAGCAAATTAA
ATCCCCCCCACACAAAATGTTTATTCTAATTATGCAAGAAATGGATTGATAATTAATACA
CGCATTAGTAAAAATCAAACACTGCAGATAAAGCCATCTTTAATGCTTCCCTCGATCCCT
CCCCATCACCCCCCAGCAAATTAACTGCTCTTCTCAGTTTCAGGCGTCTGGTTCCAGATA
TTTTTTTCTGTGCATTTGCATATGTAGATAAATATACCTCTAAAATCTATGACTTTGTTT
ATTTTTTACATAAACTATATCATAGTGTACATTTCCTCTCGCAGCAGCTTGTGTTTCTTC
CTTCAAGAGTCTGCTTAGAGATAATAAAGATCAACACTATTCCTTATAACAACACCTCAG
TATCCTGCGAGCTGTACACACCAGAGTTTATTTAACCACCTTGCTGCTGGCATGAAAGCC
TCAGGTCCTTTACCCTGGTTGGCGGGGGGGGGGGTGGGGGGGTGGGGGGCGGGGGGGGGC
AGTGAATTGGTGGCGGCAGGTGTAAGTAATTGCTGAGATTTGGGTTTGGGGAGTGGGCTC
ACGAGTGTTTATGACATTATTATAAATGAATATATGAGTGCATAAATTAGCAAAATAAAA
GGGGGCTTTTCTGGACCAATGATGAGACAGTGTTTATGAACAAAAGATCATGATTAATCC
AGTTCTGCACAAAACACTGAGGTCCATTAGAAGACAATAGGTCTTGGCTGTTTCATTCCT
TTTAAGAGCTGTTTAATATTCCACGGTATGTATGCACCATTGTTGATTACACTCTTCTAC
TGTTGAAAATCCCAGCTGAAAGTGCTCTGGGGGAGGAGAAGCTTTGGTCACAGTCCTAGC
CGTCAGGGTGGGTCACAGATTCATAGGTGTTCATTAAATTATTTTTTAAAAAAGAATACA
TAAAAATGGTGCTTAATGCAGATCAGTGAGGAAGCGTGTCACAAATCGAGGTTTTAATTA
ATACGATTCTGCTCAACTAATGCCCGATAAAAAAGATCTAAGCTGTTTCCATTTTTTGTT
GCTGTTACCAACGACACTGCAGTGAGCATTCTTGCAGCTAAATCTGTAAACACATCCTCG
ACTGTTCCTTTACCCCAGCTTCTTAGAGATGGGGTGGTGGGTTAAATTGTTTGCAAAAGT
TTATTTTCATTGAGTGATCTTTCTAAAATGGCATTTTGACCTTGTTACTGTCTTGCTTTA
AAGCCTCCATCTGACTTCCTGGAGCTTCCGGGACGGGGTCCAAAAAATAAGGCCTTATCC
TGGCATGGAAGACCCTTTAGGGTCTGTCTTGGAACTTGCCAGCCTCAGCCCCTCCCCACT
GGTGTTTACCTGCTAGGCGCACCTCACCCCCACGGGGCTACCTGTTTCTCTCAGCGGGCT
CCCTACTTCTTAGGCTTTGCGCGGCCGTGCCTTTTCAGCCAGTTTCTCCCCGGCCTTAAA
GAGCAGGCTTGAAATATCCCTGTTGGGGAGCCCAAAGTTAGATGGGCCCCACGAAACACT
GTGTTCAGAAGCCCACCGAAGCCCTGACCCTGGAAGTGGGATGCCTCATTGACATTTTTT
TCCCAATTAAAGGGAATGTTTTGCATTTTTCTAGAATTGATGAAACTGGTCAACTGTTAC
TCACCCTCCTTCCTTTGTCCCTTTCTAGGAGCCCTGGGCTCCCCCAGTGTTGCCTGGGTC
TGACTTTGCCTCAGTGAAAACTGCCTCGAATTCTTTCTTGCACCGATGGGCAGATGGGCA
GTGTCGGAGGATCGTGTCATCTGTCCCGTGGCGCTGGGTAAGTCTGCAGTGTTGTAAAGC
TGCAAACACCCTTCTGGGTGGGGCTCAGGCTGGCACCCCCCCACTGCCCCAGCCTGCGCT
ATACCACGTTCCCCTGATGCTTGCCTTGTGCCGGGCCCCAGAACCCAGAGTCATGGGGTC
CACAGCGCGGGAGTAGCGTCTCAGTGTTGTGAGTTCTGGGGATGAGGTTCGGGGTATGAT
TACAGCTTGGAAATGGCTGATTGCCATTATGGCTCCTCCTTGCCAGAGGTAAACGGGTCT
GGTCCCAGAACAGGAGGAGGACATGTGATGACTGGAGTAACGATGAGGGGCTCTGGGGAA
GGACAGGGCTGAGAGCAAGTGCTGGGACCTTTGGGACCGAGTCATATTCTAAAAAGAGCA
CAGGCTTTGGGGGAGAGGAGCTGTGAGGCCAAGGCAGCATCCCCCTGGGGAGCTTGTCAG
GAGTAACAGGAGCCACTGGCAGTGTTTGGGCTTTTGGTCCCTTTTTTTCTCTCCCAGGGG
AAGGGAGAAGGAGGCATTGCAGGAAGCCAGCCACCCTGAGCACAGACCCAGCTACAGAAC
AGACTTGAGCTGCGTGTCCTTGGCAAATCCCCAAGTGTTTCTGTGCCTTGGTTTCCTGAT
ATTAAAAAAAAAAAAAAGGACTCATAATCTCTCTCACACAGGGCTATTGAGATCTCAATG
AGGAAATAACGCAAATAAATCATCCAGCACAGTAGCCAACACGCAGTACCCAGCAAAACT
CGGTAGCTCTCCCCATCTTACCCCGTCATGAAATGCTTAACCCCCTCCCTGAGACGGGCA
GCTGCTCCCTTTCAGGGCAGGGAGACCCAACAGAGGACAACACAAATGCCAGAGAGAGTG
TGAGGGGCAATAAAAGCTGATGCTCGCCTCCCTCCCAGACATCTTCCCAGGGAAAAGTGT
GCTTTCTTGAACACCTGGGGGCCGGGGAAGGGGCTGCCCTACCACTTTGAATCGGGTTTC
CCGAAAAGTTTGGTGAGAGTTTATTTTTATGTAAATAACATATAAAAAGTCAGACTTCTC
CACAGGCAGATTTTTTGAGGCTCATATTTTACAGACTTTGGCAAGGGTCACTCGGAAGGA
ACAGTGGTTACAGTCTCCAGAGGTTCATAATTCCTGGAAAAACTTCTGGCCAAACCTGAC
TTCTCCTAAATTTCACAGAAAATTCTCCCTGGGCTGGGCTCAGGCTAAATGAGCTTTTTG
TGTGTTAGTACAGCCTTACCTAGTGGAAGCATGACTTGCACGTTGCCCTTTACACAAAAG
GGAACCTCCTCGGCCGCTGTGAACAAAGGCTCCGCTCTCCGAAATGTTTGATTTGTTTAC
TCGGGAGCGTGAGCCTGGTCAGGCACATGTCTGATACTGGGGCTATTTCTCTGCGGCCAT
ATGTAGAGCTGTCCAGGTCTCTGCAATTTAACCCTGCGCTTCATGCCAGAATCCCATTTC
CTAACTTCCTCAAGCAACGGGGCAAGGGAACCACAGCAAAAAGGAGTGTAGGGGGAGTGT
TCCCTCCGTGTCCGGCAGGGGCTAAAGGGCTTGCTGCCCTGTGGCGTCTGCCTCTAAATA
GGGATTTGGGTCGGTGACTTTTCACATCTACACCAAAGCCCTTCAGAACCCTTTCTGCAC
CACCAGCTATCCTGAACCAGAAATCCCTGTTCACAGAATTTCCCATGTGGGTGCCTCTTG
TTCTGCACCCTGCATCGCGCCCCCTCCCCCGTTTATGTAAATGACACATGTAAATGTCAC
TCTCCCAAACATTTTCACACCTGCAGCTTCAAATCAACCTTTTAATAGGTTAAAACAACA
GCACCAACAAAAACCAACAAAAACAGAGGCTCCCGAGAAACAAACAGTTTTTCCCGAAGG
GCTTGCAGTGCCTAACTGAGCTGCCAGGGCCGTCTGTCTGTCTGTTAGCCAGGAAGGCAA
ACCAGCCTGCGCACTCCACCTGCAACACGATGCTGCCCCCCCACGGCGGGTCGGAGCAGC
TGTGGCGACCCCAGGGCTGACAGATTGGGTTGTCAGGAGCAGGACAATGAGGCTGCAGTG
AGGATGGGCTCCATCCTTGAATGACTCTGCCCTCCTTGAAATTTTTCTGCTCCATGGAGG
TGCATCTCTGCCCCCGAGGACCTTGGGCATTTCACAGACAAGGAGCCCTGGCTGGCCTCG
CAGCCATCCCCCATATGCACACACGCACACGCACAGACATGCGCGCACACACACATGCTG
AGTGCCTGCACTGGGAGCATAAGGCAGAAAACTCCTTTGGAAACTGCAGAACAGAGCCTT
GTCTAGCAGAGGTCCCCTGATAAAGGTCCCACAGTTCCTGGGAACTGAACCCCTGTGAAT
GGGCCAGGAGAGGCAGCTCCCGACTCCCGTGTGGGCTGCATTCATCAGCAGGCCGGCACC
CCAGCCCTGTCACTGTGTGAGGAGCTTTCATGAGTCCACTGAACATGTAAGTCACAGTCT
GGCAGCTGGCTGCATCTGTGGTTGCTGCTCAGCCTCCAGAAAAGGGCCCCTCAACCTGCC
AGACCTCCTCGCTCCTTCCACTCACTCTGCCAGCCTGTTGCCCCAGAGAGGACACAGGCC
AGCCTCTGTGGGCTCAGGAGCCAGGGCAGGTGCTTGGCCACTCTAGGTGTTCTGGCCCTC
AAGAGGGGAGTTGGCAGCAGGACAGTCCCCACCTCCCCCCACCAGCCCTGGGCACTCAAC
CCCATTCTCTGCTCCTCTCCCTCATTGCCTTATTGGGACAGAGGCACCCCGCCAACCATC
TCTGTGCCTTTGCCATTTAGCCCAGGGCAAGCTACTCGGGAGAGGCCAAATGGCCTCATA
CTGACCCCTGCCTGGTCCCCTCTGGCCACCTCGCTCACTTGCCCGCTTGCCTGCTCAGGA
GTTGGTGCTGTGGGAGCTTCTCAAAGGCCTAAACATGTGGGCTGCCAGCCTGGGCAGGAA
ACCGTGCTGCAGCCTTCTCAGCCAAGCACTGGCCTGCCTCTCTCCCCTCGGATGCCTCCT
GTAACAGGGAGCTCCCTCTCTCCCCAGGCAGCCTGCTCAGGGCTCGCACGCAGAGCTGCT
TTGCTGAGCCCTCCCCTGCCTTTTGCATCTGCCTCCTCGGCTGTGCAGCAGCCCCCTTGC
CCCCTCTGCCCTCCGATCTCTGCAGGCTGTGGGCTCCCTCTCTTTTCAGTCCTCTCCTTT
CTGTGCTGAATGGCAATACCCCCACCAATGGTGGGAACAGGATTGGGCGCCTCTACACCT
GTCCTAACACCTCTGTCTCTGTTCTTTTAGACCTGGGACAGAGCCCTTTGCCCTGCTGTT
CTGCTAAAAGCCCAGGGGAGGGCGTGGTGCTCCCCTCCTGGGGCCAGCTGCTCCATGTCT
ATCTGTTGAGCGGCTTCTCAGCCCTCTTGGGTTTTCTATGGCCCCTTTTCCAGTTGCTAG
GGAGAACGCTCTGTATGCAGCCCCCTGCCTTTTCTGCAGGAGCTGCTGGCCTCCCGGCCA
GCCCTGGTCAGCCCTGCAGTAGCAGCAGCAGCAGCAGCAGCAGCAGTAGGCAGCCACAGC
AGGGCTGGGGGCTCCCGAGCCAGGCAGACCGGCTTGACTCCCTGCTCTCTAGCTGCAAGA
CAATTCCCTTTACTTTTCAGACTCGGCTTTTCCCCTGTGAAATGGAGATGAGAGTTTCTC
CGTCACTGGCGTGAAGTGAGGACTAAATGAGATAAGTGTAGGCTTGCACACATCAGACAC
TTCATAAATGCTTGTGGAGTAGACGGTGGGACCCAGGGAGGGAGAGAGAGGTATGTAACA
AGTGTCGCAAGAGAGAAAACAGCCTGGCCTTTCAAGACCCTGCTCCCAATACAAACGGGA
ACCTCTCCTGGCAGAGTCCCCTCTGCTGGCTTAATCGCACAAATCAAGTCAGCCGGAGGC
AGCCCCCGGCCTGTGGAACTCACAGTAGATGCAGCAGGCAGCATAAATGACATGCAGAGC
CCACATCTGCATTTAATAGACCGAGAATTTGCATTGTATATAACAGCACGAGGGGTAAAG
CATGAAGGCATAAAGGAACAGTTTTTCCCGGCGGCTTCCTTGAAGGGCCAGCTTAGACAG
GGGTCTGGGGAGGAGAAACTCAGCGGGGTCCGGGCATCCCATAGACTATGGGACAGACAT
CCATCCATGCACTCATTCTCCAAGCCACCACAGTGTACCTACCTTCCCCGGGCCCAGTCC
CAAGCGTGAGGCTGGGGATGAAGTGATGCCGGTGGCTTAGTGATGCCGGTGGCTTCCTGT
CCTCGAAGCTCAGTCGGTCTGGTGGGGGAAACAAACAGGGAATAAGACACTGGAAATTGA
GGTGATCAAGAGGGGGTGCAGGCATGGAGATTTATGGAGCCCCGTCTTGGAGCCAAGTCC
CGAACTGGGCTGTCTGCAAAGAACTCACCCGGGCAATAACCCTGCACACTGGTCTCATGA
GCCCCATTAGATTGATGAGGAAACTGAGGCACAGAAAGGCAAAGTCCTATACTCACCGTC
TCTCAGCTGGTGTGAGGCTGGGCCAGGATGGAACCCCAGACTCTCCGAGGCTCCCCACCA
CACCCTGCTGCTGAAGGCTGCTCAGCGAGGCTGTGCCGAGTGCTGGGGGGGTGTGGGTGG
GCAGGGGACGGATTGATTAGTTATAAGCACCTCCCAGCGGTGCTTGAGATCCCAGCTCCT
CTGTGGCCCAATCCGTTTGAAGGGCAGATTCAAAATTAGGTGGTAGCACCTATGGGCAGA
GGCTTATGAAAATGGCATTATTAACCTGATGTGGAGAGGGCCCTGCCTGTCTGCAAGTAG
ATTGCAGATAGAGACGGAGGGGGCTGGGCTTGTTTGTGTGGACAGTGAGTTAGAGAGGAC
AGAGAACATCCAGGGGCCCTCCAGGGCTTCCGGACGGGGAGAACCAGATCTGGAGGGGCT
GGACAAGTGGGAGGGGGAAGAGGGGTACGTCTTAAGGGTGCCCCGGCACCTCAGGGAAAT
GCCCCAGGCTGGACTTGGAGGAGGATCTCCAGCCTTGACTCTGACACAGACAGGGACTAT
GGCCCTCCCCGCACCTCGGTTTCCCATCTGTGAGATAAGAGATGGAAACCAAACGTCATT
TCGAGAAAAGCCCCCATTCCCACCACCCTCCTGGCCCCCCCCTTCCCCCACCACCCCAAT
CACGTTTGCCAGACACCTGTCTGCTTGTCAGAGCAATATTCAACAGGAGAGTTCCTTCGC
TTCCTCCCTGGAGGGAGAAGGGAGAGGTGTGGACGGGGAGAGGGGAGGGGAGAGGTGCCC
CCCACTCAGAGAGGCCGCTGAGCAGAGTTCTGCATCGGGTAGGAGTTGGGCCACCGAAGA
TTTGTGCCAACTCACGGTGCGGTGGAATCAGACAGTCTGAATTCTTCAGACACCAGCCAA
GAGTCTGTGGCGCCCCCACGTGCCACAAGGGGGCTGCCTGGGCCACATTTCTGAGCCCGA
AAAGTGAGGAGGGGGACAGTCAAGAGGGACCGGCGCTTTTGCTCTGGCAGCGGCGCTTTT
AACTGCGACAGATGCGTGCGGTGCGGCGGGGGAGCCGGCCGTGCCGGGGCTGGGGGCTGC
TGGGCGGGGGTGGTCGGGGCGGGGGGCGGGGGCTGCAGGTTGCGCCCCTCCCTCACAGAC
GGCTGCGCTGCAATGCAGCAGGCTGCGGGAGCTGTCCCGGGAGCTGTCCTGTCCGGTGGC
CGGCTTTCCAAAGTGGGGAACGAGAGATGAGGGAGGGAGCACTTCCAGGCGCTGCGTGGT
GGCCAGGCGCCCAGGAAGCCGAGGGGCCCGAGACTCTGCAGCGGGGCCAGAAAGAGAAGA
GTGGGGGAGGAGGCCGGGAGTGGTGCATGGACCAGGGGGTAGAGGGAGGTGGGTGTGGAC
CTGGGGTCGGGCGCCAGTCAGCTTGCAGCCTATGAAGGACGGAAAGGAGGGCTACAGAGA
TAGGGGAAGAGTGGGGCTGAGGATAGCCAGAGCGGCTTGGCACACAGTTTTAGGGTAAAA
GCATCAACTCTTATCTTTCCAAAAGAAATAAAAAAGCCAAAAAAAAAAAAAAAGGCATTT
GAAAGCTAGACAGCTGAATCCTTCCCAGCATGACTGAGCCGGTCACTCCAGGGTCTTCCT
TCAAAGCGTGTCTAATGGGAGACAGCGTTGTCCCAGTAACCAAATTGGGACCAGAGTCCC
AGGGAAGGGCTCATCAGGTGGCCGCTCTGCCTTGAAGAGTGGTACCCTCAGGCCCTTTTC
CAGCCAGGGGTCAGGGAGAGAGCTGGAGGGCTCGGGGAGGCAGGGACTGGGAGGGAGAGT
GGGGAGAGGAGCGCTGGGGGCTGCAGGAGGGTCTCTGGGCAGCTGGCGGGTGTCTCGTTC
CGCAACACTCTGCACCCTGGTACATCGTCCTCCGTCCACTCAACGTGGAATGATTCTCTT
CCCTCTGGATCCAGCCCCTCTAGTTCCCTTTTCACTTTGAGGCATTTGCCCCCTGTGAAT
CAGTTCCCTGCTACTCCAGAAAATTTCTCTCATACCCCAGGCCCCTCTGTTCTTTTAAAT
GGCACCCTTCACCCCCAGCCCTTCATCTTCTGCACTGTATTTTCACTTGTTGATTTAAAA
ATCCCTTTATTATGGGAAATTGCAAACAACACAAAAGTAGAGAAAATAGTACGTATTTTT
ACTGTTTACTCAATTTTCATCTTGCCATTACCCGGACACGGTTGCCGTCAAACCCTGGCC
CCTCTTGTTTCATCTAAACCCTAAACTGTCCCTCTACTCCCACTGCCCAACCCCTACCCC
TGGACTATTTCGAAGCAAATTTCAGACACCATCCTGTTTCCTCTGAGCATTTTTTAGTTT
GTATCTCTAAATAAGAAGCTTTTGTTTCTTAAAAATAAAACCACAACACCATTATCACAA
GTTAAAAAATTAATAGCCTTTCCTTAATATCATCCACCATCTATGTAGCATTCCAATATT
CTTGATTGACTCATAAATTTCTTTTACAGTTGGCTTGGTCAAGTCAGTGTTCAAACTATC
TCCTGCTCTTTCAAGGGGATCTGGGGCTCTAGAAGGTAAGTATGGCTACACATTTAGGGG
TTGAATATCTGCCTGGACCTTAAATGAGAAACTCAACCTCAGCAAACCTCAGTGTTCTCA
CTGAAAATGGGGCAAGTTCTGGGTCTCTCCTTGGGTCATTGAGAGGGTTAGAGCATTAAC
CCCTGAAGCCCCAGCCGCATGTCTAATATGTCAGAGACACTCAGCAAACAGTAGCTGCGA
GAATGATTCTTTTTCCCAGAAACGTTTAAAGGGGATTTGGGCAGGGGCAGGCAAAACATA
GCTGGCTATTGTCCATAAAACAAAAGGCTCCTGGCAGTCCAGGTCCCCTGAGTGGTTAAA
ACAGCACATGCACTACATCCCAAAAAGGGCAGCCTACAGTCTGGGGGCTGGGTTCGCCTG
GACCTCCTGGCTTGCCGTTTAGCTGCCTGACCTCAGCTGTTGTGACCTGGGACCAACAGG
GGACCCCGGCAGGTGCCTATCCACTAGATGGCACTCTCTACTGTGAGTCCAGGGGGGACC
ACCACCCCAAACTGCTTTGGCCACTGCCCAGCCCTGGGTGCCACCGGAAGATGCACACCA
CTAAAACATCGCAGATAATTTCTAAAAAGCACTTCTCAACATGTCATGCAAAAGATGCGG
TGGTTTATTTCCTTGCATAAATCCCAACCAGATTGCAGAAGCAGAGGGAATGAACATTTA
ATGACTTTGCTGAGGCCAGACACTGGTATGTCTACGCTCTCTTTAAATCCTCATCCCAGC
GACATCTGATTTCCCTTCATTTTACAGATTAGAGGACTTGGAGAGGTTAGTGACTTGCTC
GAGGTCGGCTAGGAAGCAAGACCCAGGATTCCAACTCAGGTCTGTGTGATTCCTCTGCAA
AATGGAGAGGTGGAAGGATGGATGTCAGGTCTGATGGATGGATGGATGCCTACATCAAGA
TACATGCATAGATGGAGAGATGGCTGGCTACCTCATGAATGCTGGTAAGATGGATGAGTG
AATTGAAGCACAGGTGGTGGAAGGAGAGAGGAATGAGAGAGGATAGTCAATTTCCCACCA
AGATCAAAGGCTTACTTGATCTTTGAAGAGAGGTTCCCTCTGAATGGAGCTTGCTGGTGA
AGCTCCTGCCTTCTGTTCTGCTTCTGAGCGCACTGACTGGCTCAGGTGGCTCTGGGACAA
CAGGTGGGATGCCAGCTTACAGGGACCAAGTCCCAGCTGTGGTGCTGGAGCTGCTCAGTG
GCAACTCTCCGTCTCTGCTGCTTTCACGCAGCACTGACGAAGAGCAGGCATCCGCCTTTC
CACTGGCTCTCCTGGATGACTAAGCCCTAAGCCCCAACCGCATACTCAGCCCTTCACTGG
CACTTGGCATAATTTTATCTCCTCTAAATCATCACAGCCACCCTCCATGATAGCAATTTC
TATTCTCAATTAAGTGAAAAGGAAACCGAAGTTTAGGAGTGGTAAGTGACTTACCCAAAA
TCGTATAAGGAGGAAATGCAGACCCAGGATTTGAACTCGAGTCTTCTTTCCTTCCAAACT
CATCCCCTCAACCTGTTTATTTCCTTTTCTCTATGACCATGTCTGAAGAAATCTGCCTTG
GGGTTGTCTCATATTGGACTCACTCTCTTGGTCTGTCAGTGAGCTGAACTTCTCATCCAA
TCAAATCCAAGCTTATTTCCCAAGTAATATCTCTAGTGTATTCTATTTGTAATGATCACA
CAGGCAAGGGCCACACATATCACTGGCATCCTACAGTACAATTAATCAAGTCAAATTAGA
TTCCTGGCATCTCATATTCTGACTGAATGCTAATGGTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1270, 5188..5316, 12329..12394, 13167..13199
NC_000014
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved