Homo_sapiens Locus Mono:132:AC011399.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:132:AC011399.6
Homo_sapiens
Mono:132:AC011399.6
5
SNORD45CL1
1001..1077
2077
CGGGCTGGAACGTAGATAACGTTGTTGCCTGTGAAGTTACAAGAGTTGGAGCACCCAAA
GGAAATGCATTTTTACTGGAAGCTGCTGTGGTACCTACTCCAGATGAGAAGTTAGCATGA
ATTGATTTGGTGCTGGCAGGTGTTCTGATATGATTTTTAGGAATCAAGTCTTCCAGTTCC
TTAGCAGGATCTTGAATGAGTGCATTGATTAGTTGAACTGCATATCTTGTTGATTCTGTG
CCACCCCTAAGGGAAAAAAAAAAACAGAAACAAGACCAAAAACATTAAAAAAAAAAAAAA
AGGTAATCTTAACCATCAAATAAAGTTCTTAATTATACCATACCTGACAAAGGTATGCTT
CTTATAATTTCTACTCAGAACTAGCAGTATACATTTTGCACAATTACCTTATTGTGATCA
TTCTCTCGCCATTCTTATCTTTTTGTTTATCCACATCAATATGGGCACCAGTAACATCCT
GTATTGCAGTGATGTTGCATCCTCCTCTTCCCATTATCCTCGACACCACTGAGGCTGGAA
CAGACAATTTCTTTGACCTATAAAATGAAGAATACACATGAGCTTATGAAATTAAATGTC
TCTTTATTAAGAAAGATGTCTTAGTAAGTATGTTCATGGACATTTTGGAGAATAACATTT
CTTAAATGCTAAAGAGGAAATTATTAAAAGTTTTTATTTTAGAAATTGATCTCTTGTAAT
ATTGAATTGAATTTAGTAAAGTTAAAAATTACATTGCTCTGCAGTTTCAGAGAACCTAAT
TTTAAAAATTACACTGCCATTGAAAACAAAAATTATATTTAAATCACTCACAATATAAGC
ATTCAAATCTGCCCAAAATATTACACATCAACTAAACTGCAATGACCCTGTTAAAATAAT
GAATACCATATTATTAAAATCCACACAGAATAACTATGCTAGCATATTCATTTTAAACCA
GTATCAACAGCTCATACTTAGCAATAAAAAATAAAGCCTCAGGTCAATGATGAGCTGACA
TGTATTCTGAATCTAAAGTTGATTATTAGTACTTTAGTTCTAGAATTACTGAGACATGAG
AAAGAAAAAAAGCAAGAGAAAGCCTTTACATTTGAACTACATAAAAAGCAACTGAGGTTA
TCCAAAAAAGCCAAAATTTCTTGTGTCATATAAAATATGCATGCAAAATTTACATACTGC
TTCTAATTTTGCTTTAGCATATTCTGGATTTAGTGTGGCAATGCAGTTTAAAATAATAAC
CACATTCAAATTATTCATTAATTAACTAGGTAGCCATCTCACATGAGAAAGGGAAAATAT
ATGAAAGCTAAAAAGATGGAACTAATTCTATTTACCTTCGTACAACTTCTTTCCACCCTT
CTTCTCTTTTCTGACCCCTTTTAGGGCTAGTGAGATTCAGCTTTATGTTTGGAGAGCTTA
ATGGCAATGACACTGTCTTGTAGCTGGTTGACAAGGAATTAGGAGTCACTTCACCTTCAA
GTCTAAGAAGAGACAAATAGCAAGTACAATAAAAGATAAGTTTTAAGATAGAAACTCAAG
AGACTATTCCTTTATAGCCAGAGTTACGCTGAAATATTCGTATTAAACTTTGGCACATCA
AATAATCAATGAGTCAGAAAAACAGAAATAGAGCAAAGAACCCATCATTTATTTTAGTAT
TAAAATGGATTCAGATGCCAAAAATTAGACTATAATCAATAAAAATGACATAGATAAAAT
CAAAGCATGCAAATATTTTCAACTTCAGACTATGAATCCTATAAAAATTTCTAATAATCT
CATTTCCTAACTAGCAAATGATAAAGAGGACATGGGTGAATTTCAGTTTTGAATATTGAA
GATAGATAATGTGGTAGACTTCAATTGTTTAACACAACTTGTACTTGGATTAATATACTT
CAAATTCTTGTACCAGGCATGAAGAAGGAAAGGTGCAGGTAGAGTTAACAAATCAGAAAA
ATTTACCGTGTCTGAGTTTTGGAAGTAGCAGTACTTGTCTTTTCTTCTTGGGAATGAAGG
AGCAGTGAGGGGTATTTAGAGGAATTCACATCCATCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved