Homo_sapiens Locus Mono:192:AC069285.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:192:AC069285.8
Homo_sapiens
Mono:192:AC069285.8
7
2080
GCCATAAAAAAGAATGATATCATGTCCTTTGCAGCAACACAGATGCACCTAGAAGTCAT
TATCCTAAGCGAATTAATACAGAAATAGAAAATCAAATATCACACATTCTCACTTATAAG
TGGGCGCTATATCTTGGTTATACACATACATAAAGATGGGAACAATCGACACTGAGGACT
CTAAAAGGAGAGAGGAAGGGAGAGGGGCAAGGCTTTAAAAACTTCCCATTTGGCACTTGG
TTCACTATCTGGGTGAAGCCCAAACCTCAGCATCACACAACATACCCTTGAAACAAACCT
GTGTATGTACCCCCCAAATTGAGAACAAATTAAAAATATTTTTAAAGTCTCATTTTTAAA
AGCAATATGATCAATTAAAATAACTTAAATAACTTACCAGCGACAATCCATAATTAAAAT
ATTCAGAAAGCAAGCAAGTCATCTTGTACTACCAGATTCTTTTTGAAGAATGACATTTAT
AAAACGAAGAGAACCAATTTTACCTGCCTGTACTAAAGGAAAATAAGTTCAAGAAATGTC
CTAGTTATAATTTTCAGTTAGCCCAACATTAATATTGCCCAGAGTTTAGTGTGATAGCCA
CTTTGAAGCCCTCGTAAATTCTGTCACCTTGGATGAATCACAACTGATTGGTTTATCAAT
GCATATAATTCAGATTGTTCTGAATAAAGCTGGCTTCCCTGAAGGACCCAAGATAACTTC
ATGAAATAAATGTATCACATCCAGTTAATAGATGAGGCAAAGAAAGTTATTTATTTCAAA
AGAGAAATCTTATTCTTTTGTGGTAGAGAAAAAGAAAGATTGAATAGAAAATAAAATTGC
TAATTAAGAAAAAGGAAAGCCACCTATACTTGTTTGCTCATGAAAAAGAAACCTAGCTGA
GAAGAGTGGCAGGCAAGAAACACAGTGGACTAGTATGCAGGAAGGAGAATATGGGAATAG
AAAAGTTTATTTGTTCTCTGAGATCTGCTCTTACTGAAGTGGATCGATGATGAAAATAAG
CAAGTTTGAGCATCAGAAGACCTTCCAGTCTACTTGATGCATGAGCTCTACAGTTTTAAG
AAGCAAAACTATAAAACAGTGTAAGAAGATATATTTTCCCTCATCTCTATTTGTAATTTC
ATCTATTTATCCTTAAAAGCCACTCTTACAAAAGCATAAACTTTATACATATTTGCATGG
TAGGCACATTCACATATTGCTGTTGTGTTTTTCATTTTACAAGAACAAAGTATGTTAATT
AGTGGGAAAATGAAAAGGAACCATAGACAAGCAAAAGGCAGAAAATAGAAAACACTCAGA
ACTTCACTCACAGACCACTGTCTTCAACTTTGTGTGCCCACTTCTAAGGCCTATCCTTTT
CTTAAAAATTCTTTAATTTTAAAATGCATACATAAATATGCATTTCCACATGAACATGAT
CATATCAAACATATTTTTTCAAATGTTATTTATTTCAAAAGAGAAAACTTATTTCTTTGT
GGTAGAGTAAAAGAAAGATTGAATAGAAAATAAAATTTCTAATTCAGAAAAACAGGTCTA
GGTGGCTGGCAAGATGGCCAAATAGGAACAGCTCCAGTCTGCACCTCCCAGCGAGATTAA
CGCAGAAGACAGGTGATTTCTGCATTTCCAACTGAGGTACCTGGCTCATCTCATCGGGCC
TGGTTAAACAGTGGGTGCAGCCTATGGAGGGGGAGCCGAAGCAGGTTGGGGTGTTGCCTC
ACCCAGGAAGCACAAGGGGTCAGAGAACTCCCTCCCCTAGCCAAGGGAAGCAGTGAGGGA
CTGTGCCGTGAGGAACAGTGCATTCTGGCCCAGATACTATGATTTTCCCATAGTCTTCAC
AACCCGCAAACCAGGAGATTCCCTCAGGTGCCTATGCCACCAGGGCCCTAGATTTCAAGC
ACAAAACTGGGCGGCCATTTGGGCAGACACTGAGCTAGCTGCAGGAGTTTTTTTCATACC
CCAGTGGCACCTGGGACACCAGCAAGACAGAACCATTCACTCCCATGGAAAGGGGGCTGA
AGCCAGGGAGACAAGTGATCTAGCTCAGAGAATCCCACCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved