Homo_sapiens Locus Mono:299:AC021590.10
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:299:AC021590.10
Homo_sapiens
Mono:299:AC021590.10
8
SNORD77L2
1001..1067
2067
ACACATTCCAGAAACAGTAATTAAAATACCAGTCTAGAGAAATATAAAAGAAAGAAACA
GTAGAAAAGAGAAAAAATAAAGCACACTGGTATTTTAACTTAGCCAATGCTGAAAGTATC
AACATATGTAACCACTTAAAAGAACAATATGGAGGTTGATACAATCAAAATGTACTCCAT
CTTTAAAAAGTTACCCATACAGATTTCAGATAATCATGTTTGTCAGTTTTTATTGACATG
AGTAAAATCTGTTATAGCACCAAATCACTTTTATAATATGTTGAATCAAAAATAGTAGCT
TAGAAAAATGTTTTCAGTGAGAAATATATGGTTATGTCCCTCACCTTGAAGAATGAGTCT
CAAGAAACTGACGGAAATGTTCAAACTCCAGTTTGTTGTTAAGCAGATCACTAAACTTAA
AATGCTTGTATTCTGCAGGAACATTATCCCAATATTCTGTTCGTTTAGAGACGTTAGAGA
GTGATAAAATGCCAGTTCCAATTTCACAAGTGGTGTCCTAGTGAAATAGTACTTTTCAGC
AAAAATCTCTTAAACACAACAGATTGTTTACAATTTTAAGTAGAGAAACTGAAAGAAAAA
TCAACCATTAGGCCAAAGCCATTTAATAATTCAATGGCAGAGTGGGTAAAGACTTTAGAA
TCTGGTAAAGAATCTGATTCAGATTCTAACATATCAAATTCTGTTCTGTTTATTTTCATT
CCATTCCCTTCTTTTCATAAATGTTTAGTAAATATTTACTATACAAAGCACTTGCTTGTA
AATTATTAACTTTGATATATTTTTCTAAGTATAGAAGTAAAATGTCTTTTGTAATAAGAA
AATAAAAATCATACATAATACTACCATTCAAAGATAACCACCATTAACATTTTTTAATAT
ATCCTTCCAGTCTTACTTATATATGTGTAGTTTATAAAAAATGAAGAAAAGTATAAAAAT
AAAAATTAAAAATAAAAACAAAAATAAAAAGTGAAGATTAGATACTATGATGGTTGCATA
GTTCAGCAGATTGAATTCATGAAGAGATTTACAATGTCTGATGTAGTTTCAAAATATAAA
GATAGGATTATGCACCTATTTATAGTTTTGTGATCTGGTTCTTTTTCTTAACAATGTATC
ATAAACATAAGATATTCTTTTATAACATAATTTTTAAAAGTTATAGAGTAATACAAGCTA
CTAATCTAATAATACATCCTTCAAATATAATATTAAAATATAATATAAATATAATCGCCT
TCATATAAAAGTTAATTTTTAGGTAATTTTATGACCTCTGATGTTTTGTGAACAGTTTAC
AAGCACGAAAGGGCAAAGGGGAAAAGAGTCTTATTCTTTGTAAGGCCCTTCCTTATATAA
TTCCTTACATAACTAATTCATCTCCCTATTTGTTTTTGTAAAGGATCCATGAGATAAGCT
ACCAATGTTTTAAAAATTAATTTCCTTATGTAGAAGGATTGTGGATAGTATTATAAAGTT
TAGTTCATAGAGTTTACAATACAACCTTATATCTTGCTACCTTTATGGATTTTTATGTAT
CCTTTGCAAGCTAGTAGTAGTGTATCAAATAGAGAACTTCTGGATAAGAATAAAAATTTC
AGATATGTACAAAGAAGAAAGTTTAAAAAAAAATCACCTGAAACCTTACCACTCAGAGTT
AACTATCTTTAATATTTTGGTGAGTGTCTTTTCAGATATTTCTTTTTATACTTATGGATA
CATGCAGAAATACATATATAATTTTACATAAACAGGATCGATCATACCATACCAGTTTTT
CTGTTCCAAAAATTTTAATATATCTTAAACACTTTCCAGGTCAATTAACTGTCATTTTTA
TGTAGATGCACAAATTTAATTTTATGGCTTTAAGGATTTATTATGTTTACTTAGCCAATC
CAAAAGATTCAACTTTATGAATCAAAATAACACTTTAATATCCTAATCAATCCTATGATC
TTTTTACCGTCTTCCTCAATTCCTTCCCATACTTTTTCTTCATTGTTTTCCCTATCGCTG
TCACGCAACAGTTTCTTTTCTGTTTAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved