Homo_sapiens Locus Mono:96:AL391336.19
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:96:AL391336.19
Homo_sapiens
Mono:96:AL391336.19
6
SNORA18L7
1001..1124
2124
TTCAATTCTTAAAAGGTAGTTACTTTTTAATTTTAATTATTGTGGTGGATGTATAAGAA
CATCTCATTTGTATTTTAATTGGCATTTCTCTGATAGTTAATAATATTGAGCAATTTTCG
TATCTTTATCGAACATGTAGACACCCTAGATTGTGAAATGCTTGTTCAAGCATTTTGTTC
ATACTCTACTGAATTCTTTGTAGTTTTTACTTATTATTATTATTTTCTAAGAGATGGGGT
CTGTTCTGTTGCTCAGGCTAGACTTAAGTGATGTAATCCCAGCTCACTGCAGCCTTGAAC
TCCTGGGCTTAAGTTGTCCTTCCACCTCAACCTCCTGACTAGCTGAGACTACAGGTGCAA
AACACCATATATGGCTAATTTAAAAAAAAAAATGTTTTTAAATGTTGGGGTCCAGGCTGG
TCTTGAACTCCTGGATTCAAGTGATCCTCCCTTCTCAGTCTCTCATGTAATAGGGATTAC
AGGCATGACATTGTGCACGGCTCTTTGTCTTTTATTAATGGTAGGAGACCTTTTCAATAT
ATTTTGGATTTGAGCTCTTTCTCTGTTACACAACTCCTTCTACTATGTGGCTTGTGTTTT
TACTTTTTCTAGGAATGGCTTTTAATGAATACAAAGTTCTTAATATGAGATTGTGTGCAC
ATATATATTTACATATACATATATTTCTTTATGGTAACTGCAACTGGTACACATGCTTTT
ATGTTTAGGAGTAGTTTATAGCTTTCCACTGACTATTCTTTATTTTGTCATATCAGTTGA
ACCTGAGTAAATGTAAAAATGGGTATATACTATTGCACATGTAGTCAAGAGAGCTAAGTT
ACATATGCCTGATATAAAATGTATTCTTTGTAATAGTTGGACAATAATAGTTGAATATGG
GGCAAGATATCTTATGAAAATAATTCATTATTGACTGTTTTAGTTCTTATTGGAAATGTT
CAATGCTTTAGTCATGTTATTGTACTAAAGAATGAGAGTTAGTTGAGGTCTAACACGATA
GGGCTTTATCTGTAGCCACACCATCTGGAAACATCTAGTGTAACTCTGTGATTTTGCTTT
ACTCATAGGACTATTAGAGCTGTGGGGAGGAACTATAATACAAGACAGAGTTTCTAAAAG
TGTGAAAGACCAAGTAATACATTTGCTTTTGCCTTTGGTATTGGCATATCCAACACATCT
ATGCTGTTCTTGGGTATGATAGCTTAAAAATATTATTTGAACCCATTCATATTTAGGAAG
GGTGTCAGAAATTGAGAAGCAGGCATACCCATCTACTCTAAAAATGATCCTAAAGTAAAT
TGCTTGAATAAATTAGATTGAAAAGATTCTTGGTGGGGGACTTTTTAAAGTTGTCCTCAA
TATGTCCATATTCAAGTGAAGGTAAGAGAAGCCCAGACAAAAAAAGTTGTGAGATGACAG
GACAACTATGGATTAAGCATCAATTCTTTTAAAAAGGGCTGACTTAAAAATAAATCTTGG
CTCAATTAGAGGAACTTAGCTGACCTTGATGGGCAAAGAAAGGAATCACAACATGTGAAA
TTCTTTGGATAAAGAATGTATTGACTTAAAAAAATGAGAGTAGCTTTTATATAGCATTGG
TAATTCCATTTAAAGAAAACTCTATTGTTATATATTCAAACTTCTGGACTAGTGAAATTA
AACAGTATCCTTAGATTGCACAGTAGGTTGTTTAAAATAGAAACTATTCTGGCAATTATT
TATCTGTGAAAATTAAAATTTTCTATCTGTTCTACAAAAGGCAGGCTAACCAAATGACAG
ATAGAAAGAAAATAACTCAGAAACTAATTAAAGTGTATCCTCAGATTTAAGGTAGATTAC
TCTTTATTAAAAATTACAGTTTAAAACATTGGTATCCCAAATATTCAATTATAAAATTTT
GGGCCCATGAAAACATTCTCATGGATAAACTTTGTAGTAAATACACAGCATAAACTTGAA
ATTTAAATAAACATATACCAATAAAAACATCTATTTTATATAATTCATGGATATAATTTA
TATTTAACATTTTATTTAAGCACTTTAATACACAGTATCACTGTAAACAAAATATGAATA
CCTCTGTACCCAGCAAAAGAGCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved