Homo_sapiens Locus Mono:314:AP000577.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:314:AP000577.5
Homo_sapiens
Mono:314:AP000577.5
11
SNORA7A
1001..1139
2139
TACAACAGAGCTCGATGTTGAGGAGGGGTGGACAGCAGGTCACTAACAGCCAGGAAACA
CACTGTGGAAGAACAGAAAGAGAAGGAAAAACAAATGTAACTATCAATAGCTTTCCCTTG
CTTATCTGTATCCTCCAGGAAGCCCTCCCTAATGACCACCAAGGCCCTGGCAAATCTGAC
CCATTTCACAGCCCTGACCAGAGCTGGACCCAGGGTCTGCTCTCAGTGTGCTGCTCATTT
GCCCAAGGCTCCAAATGGTCGAAGGGCCCCAGCCAAACACTGTTTAGTAAGAGAAATTAA
GTCTTTATTGTTGGTTCCTGGGATCCATGAATGGTCAGTTGTTAGAGGGATGGCTCAGCA
TAGGGGTGTCGCTTCTGTGGTTCACTGTCCCAAGGTCTTGCCATCATCTCCAGTGCTTAC
CCTGCCCTGTCACTCTCATCTCCCAGGCCCTGGAATTCAGAGTTCTCTAACGCAGAAGCC
ATTTCCTTTTCTTAATATTTCTTCTGCAAACTTTCTGAGAGTGGGGAACAAGTTTCCCCA
AGCCCTCACCAAAATCAGAGAAGAGACTTTTCAATGGTAGGAATGACTCCTCATGAGGGT
TGTGGGCTCTCTGAGGATCAAAGGCCTTCTGCAGTACAGACTAGGAGCTGGCTGAGGTGG
GTCAATACCACCTGGTTTGGTCAACATGCCTCTCTTCTTCCTCAACAAAGAGCCCAACTG
TGTTTCCCTAAACAGATGAAGAGCTACCTAGGATGAGAGACCTGGCCCTGTTTCTTCCTC
TAGACCAATAGAGGGGGAATTTTTGCCTCCCTTGAGGCATTTGGTAAAATCTGGAGACAT
TTCTGTTTGTCAAAACCGTGTGTGGGAGGGGTACTACTGTTATCAGGTGGGTAAAAGCCA
GGGATACTGCTAAGCATCCTACAATGCACAGGACAGTCCCCACAATGAAGAATTATCCAC
CTCAAAATGTCAATAAAGCTGAGGTTGAAAACCCTGCTCTAGAGCTTCCAGGATCACCCC
TGCAGAGTGGCTAATATTCTGCCAGCTTCGGAAAGGGAGGGGAAGCAAGCCTGGCAGAGG
CACCCATTCCATTCCCAGCTTGCTTAGTAGCTGGCCATGGGAAGACACTGTGCAACACTG
TAGAAAACCCTGCTCTAGGCCAGGCGCGGTGGCTTGTGCCTATAATCCCTATAATCCCAA
CACTTTAGGAGGCCGATGCGGGTGGATCACTTGAGGCCAGGAGTTCAAGACCAGCCTGGC
CAACATGGAGAAACCACCATCTTTACTAAAAAAAAAAAAAAACAAAAAAAAAAACAAAAT
TAGCCGGGTACGGTGGCGTACGCCTGTGATCCCAGCTACTCGGGAGACTGAGGCACTGGA
TCACTTGAGCCCAGGTGGCAGAGGTTGCAGTGAACCAAGACTGTGCCAAGAAAAAAAAAA
AAAAAAAAAAGCCCTGCTCCATGGCCTGCCCAGCTTTCCTTGGCAGCAGGGCAGGAGAAG
CCAAAGAAAACTTCTCTAGGAGCCTGGAAAAGGACTGATTCCTATCCCAGCCTCCTCAAA
GGGGCACCTCAAGAAGAAATGCACATCACAGTGGGGAGTGAGACTAGGCACAATTTAATC
ACAGCCTCAGCATCAACCCGTGGGAGCACAGCACAAAGAAACAACCAACCATGGCTTTGT
AGAAACAGACATGCCAGGCTCTTCACTGAGGAGGAGGAAGAAAGGCATGGTGACCAAACC
AGGCAGGGGTAAGGCAGAGATATTTACAGTCCTACAAGTGTCTGCTTGTCAGATTCGGCC
AGCACTGCTGGGTTCTTAAACCCTTGTACCCGCCTTACCACTGGAATCCACCGATGGGTT
CTGCAAACCTGTGCCGGATCAGGAAAGTGGCAACAGCTTCAGCTACCTGGAAATGGGAGA
GATATTCCAGGCCATATAAAGGTTAGTGATGGGGCTTAGCCTTGGGCTGTGAGCTACTGT
TAGATGGTTAGGCTCTACGGTGCCCTCATCCCACCCACAGGTCTGAGTGGCTTGAAATTA
AAAGGACCTAGGCCCTCCCTAGCAGAGCTAGAAGACTCCTCCCCACTATCCTTGCCAGGG
ATAGCTCCATAGAGCTCAAGAGGAATGACGTGAAGGGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved