Homo_sapiens Locus Mono:174:AC022296.34
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:174:AC022296.34
Homo_sapiens
Mono:174:AC022296.34
3
SNORA33L1
1001..1107
2107
CTTGTGAAGAGGCTTGGAATAAGAGAGCTATGATCATGTTCTCAGGGCCCAGTGCAAAA
TGTAAATGCAGGGCACCTTGTTCAAAAAAAAAAATTTTTTTTTTTTTTGAGATGGAGTTT
CACTCTGTCGCCCAGGCTGGAGTGCAGTGGTGCAATACCAGCTCACTGCAAGCTCCGCCT
CCCGGGTTCACGCTAATTCTCCTGCCTCAGCCTTCCCAGTAGCTGGGACCACAGGCACCT
GCCACCACGCCCGGCTAATTTTTTTTTTTTTTTGTATTTTTAGTAGAGACGGGGTTTCAC
CGTGTGTTAGCCAGGATGGTCTCTATCTCCCAACCCCGTGATCCGCCCACCTTGGCCTCC
CAAAGTGCTGGGATTACAAGTGTGAGCCACTGCGCCCAGCCCCCTTGTTAAAAAATTATC
AAGAATTTAAAGATGGCTGACAACAGAGCATTTAATTGAGTGTCCAAGAGCAATCCTGCC
ATTTCTGAGAGCAGAGTCCTGGGCAACTGCACAAGGCTGCAGGCCTCTAGAGGCATGCCA
TGCCCCTAGACCTCAACTGTTTTTCCATCAAAAATCAGTATCACCAGCTTTTGTCCTGCC
CAACTTTCCAAACTTGGCTGCCATTAATTTCTCACATCCCTGCATGCACTAGCCACTCCC
CTTAAGTAGAGGTGAAGAGAATTCCTCTTCTTCTTCTCCCATAACATGTTTTAAATTTAA
AAAAAAGAAATTTAACCAGGAGTGGTGGCTCACACGTATAATCCCAGCGTTTTAGGAGGC
TTGAGGCAGGAGGATCACTTGAGCCTAGGAGTCCAAGACCAGCCTGGGCAACGTAGCAAG
ACTTCATCTCTACAAAAAATAAAATTAGTAGGGCATGGTGGCACGCACCTGTAATCCCAG
CTACTCAGGAGACTGAGGCAGGAAAATCACTTGAGCCCAGGAGTTCGAGGCTGCAGTGAG
CTGTGATCCCACCACTGCACTCCAGCCTGGCTGACAGAGTGGGACCCCATCTCAAAAAAA
AAAAAAAAATTAAGCTGGTGATAGTAAAGCCATGTTATGAGCTTTAAGGACATTGAAGTC
ATTAAGATTCCTGGAAATGGCTACAAAAAATTTTTAAAAAACAAAAACCAGAGGAGCCAA
GATGGCCGAACAGGAACAGCTCCGTTCTACACCTCCCAGCGTGAGCAATGCAGAAGACGG
GTGATTTCTGCATTTCCATCTGAGGTACCAGGTTCATCTCACTAGCGAATGCCAGACAGT
GGGCACAGGACAGTGGGTGCAGCACACCTTGCGCCAGCCGAAGCAAGGCGAGGCATTGCC
TCACTCAGGAAGCGCAAGGGAGTTCCCTTTCCTGGTCAAGGAAAGGGGTGACAGATGGCA
CCTGGAAAATTGGGCCACTCCCACCCAAATACTGCGCTTTTCCGACAGGCTTAGGAAACG
GCGCACCAGGAGATTATATCCCGCACCTGGCTCGGAGGGTCCTACGCCCACGGAGTCTCG
CTGATTGCTAGCACAGCAGTCTGAGATCAAACTGCAAGGCAGCAGCGAGGCTGGGGGAGG
GGCACCCGCCATTGCCCAGGCTCGCTTAGGTAAACAAAGCAGCTGGGAAGCTCGAACTGG
GTGGAGCCCACCACAGTTCAAAGAGGCCTGCCTGCCTCTGTAGGCTCCACCTCTGGGGGC
AGGGCACAGACAAACAAAAAGACAGCAGTAACCTCTGCAGACTTAAATGTCCCTGTCTGA
CAGCTTTGAGGAGAGCAGTGGTTCTCCCAGCACGCAGCTGGAGATCTGAGAACGGGCAGA
CTGCCTCCTCAAGTGGGTCCCTGACCCCTGACCCCCGAGCAGCCTAACTGGGAGGCACCC
CCAGCAGGGGCAGACTGACACCTCACACGGCCGGGTACTCCTCTGAGACAAAACTTCCAT
AGGAACGATCAGACAGCAGCATTCGTGGATCGCGAAAATCTGCAGTTCTGCAGACACTGC
TGCTGATACCCAGGCAAACAGGGTCTGGAGTGGACCTCTAGCAAACTCCAACAGACCTGC
AGCTGAGGGTCCCATCTGTTAGAAGGAAAACTAACAAACAGAAAGGCCATCCACACCAAA
AACCCATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved