Homo_sapiens Locus Mono:32:AC078994.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:32:AC078994.3
Homo_sapiens
Mono:32:AC078994.3
2
SNORA75L7
1001..1119
2119
ATCTGTCGATTTGCAGAGGGATTCCACCAAATTCATGACTACATAATGAGTGCATATTC
ACATGAGGAAACTATCTCATACCAGGGTAAGAACATTAGAAAGCAGGTAGAACAATGCAC
AGTTATCATATAGGTCCAGGAAATATTTCTGCCCATATTTCTACCAGCCAGTGTGTGAAG
ACCTATTAAAATGAGACATTGGATAGAATTCGCCAAAAGGTATGTCCATTTAATGATGGG
GTTAAATTTGCTTTAGATTAAAGGCTGCCCTGAACCCGCCTATGAAAACTTAAAAGCAAG
CCTCATAAAATAATGCAAACTAAATTAGTTATATTCCAGAAAACTAAAAATAAATATCTA
AAGCAATTCAAGGAATTTAGCATCTGAATTCTAGCATGCAATACAAAACAGCTAGAGATG
CAAAGAAGCAGAAAAATATGATACAAATTGGAAAAAACAGAACATGAAATGGCATAAATG
ATAAAATCAGCAGATAAGGACTTTAACAGAAGTATTACAAATGTGTTCTCTATGTTTGAG
AATGTAAAGAAAAGCACAGCATGACAATCAAAAATGTGATTTTTTTTTAATATTACAAAA
CAGACTTCTGTAAGTCAAAAAAATCTAAAATAAGAAATAAGCTGAATGAGATTAATAGTG
GATTGGAAAATACAAAAGAAAATATTAATTACATAGCAATAGAAACCATGGGAAATGAAA
TATAGAGGGAAACACCATTGATAAAAGCAAGCAGGATATCTCTAATATAAAACAACAATA
AGTGAGCTAACATACAGATAATGGAATTTCAGAAGGAAAGGAAGTTTGAGGTGGGGGGCA
GACATACATAATGAAGAACACTTTCTAATTTGGTGAACTACAAACTTTAGAACTTAAATA
ATCTCCAACATAACAAATATTTGGAAAACCAAACCAAGACACCTCATACTCAATTTGAAG
AATACCAGTAATAAAGAAAAAACATTAAAGTAGTCAGAGTATTCTTATTGAGCTCCTTTC
TGTCTACTGGTGGCAGTCTATGGATTTGCACAAGACAAAACTAGCGCTATTTTACCTTCT
GTCTTTAAACAGGTATATTTGACTGTTTTGTGAGAAATTCTGGCATTTAAAAAAAGGCAG
CCAGAGAAAAGGAAACAATATATTCAGAGGAACAGAGATTGGAATGACAGCATATTTCTC
ACTGGAGGTCAAGCATGTCAGAAAACAATGAATAATATATTTAAATATTGTGAGGGCAGA
GTGAACCAGCTGTCAATTTGGAATTCTATATACAACAAAAAATACCTTTCAAAAATTAAA
GTTAAAGACCTTTGCAGACAAGCAAAACTGAGAACATTTATCACCAGCAAATCCATACAA
AAAGCATGTTAAATAAAATTATTTTGGCAGAAAATAAAATGAGGCTACACGGAAATTTAG
ATTTACACAAAGAAATAAAGAGCACTGGAAATGGCCAATATGTGAATACATATAGAACTA
ATTTTGATTTTTAAAAATCTTATTAAAATAATTAAATATATAAAGCAAAAATAACAACAA
TGTATTCTGGAATTTATAAAATGTAGAAGAAAAATACAGGACAAAAATTGCACAGAAGAC
AGGAAGAGAAATTGTAGAATTTCTTTTAAATTATGCTTAAAGATCTGGAGTACATGTACA
GAAAGTGCAGTTTTGTTACATAGGTATACACGTGGCATAGGTATACACGTGGCATGGTAG
TTTGCTGCACCCATCAACCCGTCACCTACATTAGGTATTTCTCCTAGTGTTATCCCTCCC
CTAGCCCCCCATCCTCTGACAGTGTGTGATGTTCCCCTCCCTATGTCCATGTGTTCTCGT
TGTTCAACTCCCACTTACGAGTGAGAACATGTGGTTTTGGTTTTCTCTTCTTGTGATAGA
TTGCTGAGAATGGTGGTTTCCAGCTTCATCCATGTCCCCGCAAAGGACATGAACTCATCC
TTTTTTATGGCTGCATAGTATTCCATGGTATATATGTGCCACATTTTCTTTATCCAGTCT
ATTATTGATGGACATTTGGGTTGGTTCCAAGTCTTCGCTATCGCGAATAGTGCCACAATA
AACATACGTGTGCATGTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved