Homo_sapiens Locus Mono:74:AC012291.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:74:AC012291.11
Homo_sapiens
Mono:74:AC012291.11
15
SNORA25L11
1001..1118
2118
TTGAGACGGAGTCTCGCTCTGTCACCCAGGCTGGAGCGCACTGGCATGATCTTGGCTGA
CTGGAACCTCTACCTCTCAGGTTCAAGCAATTCTCCTGCCTTAGCCTCCCGAGTAGCTGG
GATTACAGGCATGTGCCACCACGCCCAGCTAATTTTTGTATTTTTTAGTAGAGATGGGGT
TTCACTATGTTGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAATGATCTACCCACCTCGG
CCTCCAGAAGTGCTGGAATTATAGGCATGAGTCACTGCACCCGGCCTAACTGAAGAATCT
TAATAAAAATGCTCTTCCAACTTCTCTGACAACCGGATATTAACAGACAAAACTGCCTTG
GTGCCAAGAAACAGCAATTAGTAATATATTAGAGCCTCTTTTTTATCTTTTGATATTCTA
GGATTAGAAAATGTTAATAAAGACATAAGATCTATAAATCTACAAAGAAGGTGCAGACTG
TGCATACAAGACTGTTGCTGTTCACAAGACTCACGGAACTAGAACTTCTTGATTAAAGCT
ACCTTCACTCCTAACGCACTCTCAGCCAGATCAATCCCTCAGTTCTATTGAAACTACTTC
TTCATTATCTCAATATCCATTTCCTTCATCTCCACTGCCAACTGCCTAATCGGATCTGCC
AACAATTCTGTCTTGCCTGGACTACTGTAAAGCCTCCTAATTGGTATCCATGACTCTAGT
CTTTGCCTCTGCTAAACTCTTTTCCTCACTGCAGCCCAAATGACCTTTCCAAAACACAAA
CCTGACTGAAACACTCCCCTCTTAAAAAACCTTTCAATGGCTTATCATCACTGACAGGAT
AAAGCCTAAAAGACCTAGCTTCAAAGAGCAAAAAGTTTAATCACACAGTAGCCCCTTCTT
ATTCACGGTTTCGCTTTCCGTGGTTTCAGTTAACTGTGGCCAATCTTGGTCTGAAAATAT
TAAATGAAAAATTCCAGAAATAAACAATTGATAAATTTTATAGGTCATTTCAAAGAGGCT
GCAAAACCAAGAGCTCTTAACGCTGTGAGCAAAGATGGAAGTTCTCTCTAGGATGCCATG
GCACTCGATGGTGGTATGTTTTCCTGGGGAGATATAAGACATAGGTGTTATATGACATAG
TAATCTATGATTGTTGCCATGGGAGAGTTTTAAAGATTAACCAAAGTAAAAAGAAAAAAC
AAATTGTAAACTTTGCACTGTTCTGAGCAGCATGATAAAATCTCATGCCACCCCACCTGG
GATGTGAAACAGCCCTTCGTGCAGCATAGCCACCAGGTATACACTAGGTTGCCCGTTACC
CATTAAGTAGCTGTCTTGGTTACCAGATCAACTGTCCTGGTATCTCAGGGCTTGCGTGCA
AGTAACCATTATTTTACTTAATAAATGGCCCCAAAGCACAAGAGTAGTGATACTGGCATA
TTACTATAGTTGTTCTATTTTATGATTATTGTTGTTAATCTCTTACGGTGCCTAATTTAT
AAACTAAACTTCATAATAGGTGTGTATGTATAGGACAAAACACAATATATATAGGGTTTG
GTACTATCTGCAGTGTCAGGCATCCGCTGGGGATCTGGGAAAGTATCTTCTGTGGATAAG
GGGGACTGCTGTACTCTCTTGGCCAGGGTTACAGGCATCGCACAGCCTCTACAGACGGCA
ATTTGGCATTATCTATTAAAACTAAAAATATTTATACTCTTTAACCCAAAAATTCCATTC
CTAGGAATTAATCGTACAGGTATACTTTCATGTGCAGATGGACTTATATACAAGGATATA
TACTGCAGCACTGTTTAAATTGCAATAGACTAGAAATCACCTAAATTCCAACAATACAGG
ATTGATCCAATGAATTATGGTATATCCATATTCCAAATAAATAAAACAAACATCCAAATA
AAAAAGCAAGGTAAAGGATAGAAAGTATAATATGCAACCTTTGTGTGGAAAATACACAGA
CACACACACACGTATTTTCAAATGTAAAGAAAATAGCTCTGGAAGGATGCCCAAAGAACC
TGCTTTGGTAACTGCCTTCAGGGAGAGGACCTGAGCAGTGGGGATAGGGAAGTGGGGAGA
CTTAATATTCTCTATGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved