Homo_sapiens Locus Mono:224:AL354980.16
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:224:AL354980.16
Homo_sapiens
Mono:224:AL354980.16
1
SNORD59BL1
1001..1068
2068
CATCTAGGAAGTGAGGAGCGCCTCTTCCCGGCCGCCATCCCATCTGGGAAGTGAGGAGC
GTCTCTGCCCGGCCACCCATCGTCTGAGATGTGGGGAGCACCTCTGCCCTGCCGCCCCGT
CCGGGATGTGAGGAGCGTCTCTGCCCGGCCGCCCCGTCTGAGAAGTGAGGAGACCCTCTG
CCTGGCAACCGCCCCGTCTGAGAAGTGAGGAGCCCCTCCGCCCGGCAGCCGCCCGGTCTG
AGAAGTGAGGAGCCCCTCCGCCCAGCAGCCACCCCGTCTGGGAAGTGAGGAGCGTCTCTG
CCCGGCAGCCGCCCCGTCCGGGCGGGAGGTGGGGGGTCAGCCCCCCGCCCGGCCAGCCGC
CCCGTCCGGGAGGTGAGGGGCGCCTCTGCCCCGCCGCCCCTACTGGGAAGTAAGGAGCCC
CTCTGCCCGGCCACCACCCCGTCTGGGAGGTGTACCCAACAGCTCATTGAGAACGGGCCA
TGATGATAATGGCGGTTTTGTGGAATAGAAAGGGGGGAAAGGTGGGGAAAAGATTGAGAA
ATCGGATGGTTGCCGTGTCTGTGTAGAAAGAGGTAGACATGGGAGACTTTTCATTTTGTT
CTGTACTAAGAAAAATTCTTCTGCCTTGGGATCCTGTAGATCTGTGACCTTACCCCCAAC
CCTGTGCTCTCTGAAACAGGTGCTGTATCCACTCAGGGTTGAATGGATTAAGGGCGGTGC
AAGATGTGCTTTGTTAAACAGATGCTTGAAGGCAGCATGCTCTTTAAGAGTCATCACCAC
TCCCCAATCTCAAGTACCCAGGGACACAAACACTGCGGAAGGCCGCAGGGTCCTCTGCCT
AGGAAAACCAGAGACCTTTGTTCACTTGTTTATCTGCTGACCTTCCCTCCACTATTGTCC
TGTGACCCTGCCAAATCCCCCTCTGCGAGAAACACCCAAGAATGATCAATAAAAAAAAAA
GAAAAAGAAAAAAAGAAAATAGGTAAAAAACATGATTAAGCACTCACTGATGAGTAGCTT
CTGACTTTCATTCTGAGTTTGCTGAACCCAGATGCCATTCCTGGGAAGGAAAAAAATAAA
CATGGTAAGCAATCACAGAAGGGGAAATCTGAATACCAACAGTATAAATTAATCCTCTAC
CTTGAACGCAATCAGAAAAATGCACATTAAAATAATAATGAGATACCACTTTACACCCAT
CAGGTAGGCAAAAATTAGTCCGGTAATACCAAATATTAGCAAGATCCAAGATGAGAGGAA
ACAAATCCCTGCTGTACTCCTGGAGTGTGAGACATGCAGCCGTTTCCATTTTTGTAGTAA
AGAATCTGGCAGAGCTTTGTGAAATTAAATATGCACATGCTCTATGACCCAGCAATTCTA
CTCTGTCGACCAAAAGAGTGGAACTCTGTAAAATATTTGAAGAGATTTATTCTGACTCAA
AGATGACTGACCATGGCCTGTGACACAACCCTCAGGAAGTCCTGAGAACCTGTGCACAAA
GTGGTTGGAGTGCAGCTTGGTTTTATACACTTTAGAGAAGAATGACACATCAATTAAATA
CATTTAAGACATACATTGGTTTGGTCTAGAAAGGTGGAACAACTCAAAGTGGGGGCTTCG
AGGCTATAGGTGAATTTAAATGTTTTCTGGTTGACAATTGGTTAAGGTTGTCTAAAGAGC
TGGGATAGATAGAAAGGGAATGTTCAGGTTAAGATAAAGATTGTGGAGACCAAAGCTCTT
TTGAAGTCTCATAATGGCTGCCTTGGAGACAATAGGTGACAAATGTTTCCTATTCAGATC
TCAGTTAGTCTCTTTAGGATTGGGAGGATCTGGAAGAAAAAGATGTATATATATATACAC
ATATATATATTTATATATATGTATATGTATATGTATTTTTATATATATGTATTTATGTAT
AAATATATATATATATATATATTTTTTTTTTGAGATGGAGCCTCGCTCTGTCTCCCAAGC
TGGAGTGCAATGGCGCGATCTCCACTCACTGCAGCCTCCAACTCTTGGGTTCAAGTGATT
TTCCTGCCTCAGCCTCCCAAAGTGCTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved